Incidental Mutation 'R2157:Abca13'
ID234930
Institutional Source Beutler Lab
Gene Symbol Abca13
Ensembl Gene ENSMUSG00000004668
Gene NameATP-binding cassette, sub-family A (ABC1), member 13
SynonymsA930002G16Rik
MMRRC Submission 040160-MU
Accession Numbers

NCBI RefSeq: NM_178259.3; MGI:2388707

Is this an essential gene? Probably non essential (E-score: 0.123) question?
Stock #R2157 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location9191942-9684259 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 9577170 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Leucine at position 4528 (M4528L)
Ref Sequence ENSEMBL: ENSMUSP00000040465 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042740]
Predicted Effect probably damaging
Transcript: ENSMUST00000042740
AA Change: M4528L

PolyPhen 2 Score 0.968 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000040465
Gene: ENSMUSG00000004668
AA Change: M4528L

DomainStartEndE-ValueType
transmembrane domain 20 42 N/A INTRINSIC
low complexity region 358 379 N/A INTRINSIC
low complexity region 441 451 N/A INTRINSIC
low complexity region 820 831 N/A INTRINSIC
low complexity region 1382 1393 N/A INTRINSIC
low complexity region 1721 1737 N/A INTRINSIC
low complexity region 1859 1872 N/A INTRINSIC
Pfam:ABC2_membrane_3 3288 3740 4.7e-21 PFAM
low complexity region 3796 3809 N/A INTRINSIC
AAA 3835 4019 8.08e-12 SMART
transmembrane domain 4206 4228 N/A INTRINSIC
Pfam:ABC2_membrane_3 4317 4646 1.6e-33 PFAM
AAA 4721 4909 8.86e-9 SMART
Meta Mutation Damage Score 0.21 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.7%
Validation Efficiency 100% (80/80)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] In human, the ATP-binding cassette (ABC) family of transmembrane transporters has at least 48 genes and 7 gene subfamilies. This gene is a member of ABC gene subfamily A (ABCA). Genes within the ABCA family typically encode several thousand amino acids. Like other ABC transmembrane transporter proteins, this protein has 12 or more transmembrane alpha-helix domains that likely arrange to form a single central chamber with multiple substrate binding sites. It is also predicted to have two large extracellular domains and two nucleotide binding domains as is typical for ABCA proteins. Alternative splice variants have been described but their biological validity has not been demonstrated.[provided by RefSeq, Mar 2009]
Allele List at MGI

All alleles(3) : Targeted(3

Other mutations in this stock
Total: 83 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310022B05Rik A T 8: 124,651,429 probably benign Het
4930590J08Rik A G 6: 91,917,698 probably null Het
4930590J08Rik T A 6: 91,942,487 M709K possibly damaging Het
A930011G23Rik T G 5: 99,232,097 I394L probably damaging Het
Abcb1b G A 5: 8,824,791 A484T probably benign Het
Actn1 A T 12: 80,173,117 M660K probably benign Het
Adgra3 G T 5: 50,001,941 N322K possibly damaging Het
Ahnak A G 19: 9,000,684 I56V possibly damaging Het
Amotl2 A G 9: 102,730,589 probably benign Het
Apoa1 T C 9: 46,229,173 V34A probably damaging Het
Arrdc1 G A 2: 24,926,975 A113V probably damaging Het
As3mt A G 19: 46,707,792 D13G probably benign Het
C77080 C T 4: 129,224,124 R249H possibly damaging Het
Cald1 A G 6: 34,686,041 Q13R possibly damaging Het
Ccdc28a G A 10: 18,230,455 T41I probably benign Het
Ccdc30 A T 4: 119,333,724 probably benign Het
Cct2 T C 10: 117,062,809 probably benign Het
Cdh12 T C 15: 21,583,787 I571T possibly damaging Het
Cdh15 G A 8: 122,862,024 R279Q probably damaging Het
Ckm T C 7: 19,421,354 S372P probably benign Het
Comp C T 8: 70,379,570 Q554* probably null Het
Csf2ra T C 19: 61,227,071 T70A probably benign Het
Csmd3 T C 15: 47,695,787 E2256G probably damaging Het
Dicer1 A T 12: 104,702,949 V1158D probably benign Het
Dner A G 1: 84,383,938 F650S possibly damaging Het
Dnm3 T C 1: 162,307,893 N437S possibly damaging Het
Dpy19l2 A T 9: 24,584,632 C597S probably benign Het
Dpy19l2 T C 9: 24,680,780 I176V probably benign Het
Edf1 T C 2: 25,558,031 probably null Het
Enpp3 A G 10: 24,776,878 F727S probably damaging Het
Epb42 C T 2: 121,021,762 M583I probably benign Het
Foxred1 A G 9: 35,205,363 F117S probably damaging Het
Fstl5 T A 3: 76,708,065 M811K possibly damaging Het
Gm5117 A T 8: 31,738,194 noncoding transcript Het
Gm6803 A T 12: 88,018,711 S21T unknown Het
Gpm6a T C 8: 55,058,798 S236P probably damaging Het
Grik1 G A 16: 88,056,124 A57V probably damaging Het
Hdgfl2 G A 17: 56,098,691 V476I possibly damaging Het
Il17b G T 18: 61,690,368 W91L probably damaging Het
Jph4 C A 14: 55,113,527 R344L probably benign Het
Map3k21 A G 8: 125,937,266 D522G probably benign Het
Mast2 A G 4: 116,322,283 L398S probably damaging Het
Mbtd1 A G 11: 93,910,388 T132A probably benign Het
Mbtps1 G T 8: 119,542,727 T208K probably benign Het
Mr1 A G 1: 155,146,630 probably null Het
Mthfsd G A 8: 121,101,501 L140F probably damaging Het
Mybpc2 C G 7: 44,509,845 D594H possibly damaging Het
Nalcn T C 14: 123,409,752 M570V probably benign Het
Ncam2 T C 16: 81,490,389 I397T probably damaging Het
Ndufs4 C T 13: 114,316,978 V75I probably damaging Het
Nek4 T A 14: 30,979,968 probably null Het
Nfatc1 G T 18: 80,635,845 A762D possibly damaging Het
Npc1 A G 18: 12,191,809 I1209T probably damaging Het
Olfr1206 A T 2: 88,864,869 N88I probably benign Het
Olfr370 T C 8: 83,541,621 I159T probably benign Het
Pak7 T C 2: 136,100,957 D421G probably damaging Het
Pias1 A G 9: 62,912,830 V285A possibly damaging Het
Pigg T A 5: 108,318,889 I212N probably damaging Het
Plcd3 A T 11: 103,071,148 C711S probably benign Het
Plscr5 G A 9: 92,198,497 R12K probably benign Het
Plxna4 T C 6: 32,516,974 I236V probably benign Het
Ppp1r26 T C 2: 28,452,358 F667L probably benign Het
Pqlc2 A T 4: 139,301,855 V106D probably damaging Het
Prkx A G X: 77,771,314 F247L probably benign Het
Qpct G A 17: 79,070,686 R95Q probably benign Het
Ralgapb G T 2: 158,437,472 M159I probably benign Het
Rnf145 T C 11: 44,555,170 L277P probably damaging Het
Scn9a A G 2: 66,536,325 S705P probably damaging Het
Slc4a8 A G 15: 100,806,373 T750A probably damaging Het
Syne2 A G 12: 76,094,456 E6114G probably damaging Het
Tat T C 8: 109,997,604 M375T probably damaging Het
Tex10 C T 4: 48,436,522 probably benign Het
Tmprss11e T C 5: 86,713,728 K320E probably benign Het
Tnr T C 1: 159,858,270 I357T probably damaging Het
Vmn1r229 A T 17: 20,815,376 R294S possibly damaging Het
Vmn2r116 G A 17: 23,401,469 D726N probably damaging Het
Vpreb2 T A 16: 17,981,070 L140* probably null Het
Wfs1 G A 5: 36,967,942 P535L probably damaging Het
Xdh A G 17: 73,922,537 L307P probably damaging Het
Zfp160 A G 17: 21,020,828 S53G probably benign Het
Zfp319 A G 8: 95,328,031 C515R probably damaging Het
Zfp747 A G 7: 127,375,757 F24L possibly damaging Het
Zzef1 A T 11: 72,848,634 probably benign Het
Other mutations in Abca13
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00094:Abca13 APN 11 9297443 missense probably benign 0.24
IGL00481:Abca13 APN 11 9290969 missense probably damaging 0.99
IGL00707:Abca13 APN 11 9291586 missense probably damaging 0.99
IGL00755:Abca13 APN 11 9542102 missense possibly damaging 0.87
IGL00771:Abca13 APN 11 9290870 missense probably damaging 1.00
IGL00802:Abca13 APN 11 9297717 missense probably damaging 0.96
IGL00807:Abca13 APN 11 9378285 missense probably benign 0.10
IGL00977:Abca13 APN 11 9399284 missense probably damaging 1.00
IGL01064:Abca13 APN 11 9483855 missense probably benign 0.01
IGL01100:Abca13 APN 11 9274673 splice site probably null
IGL01290:Abca13 APN 11 9256232 missense probably damaging 1.00
IGL01299:Abca13 APN 11 9298743 missense probably benign 0.22
IGL01302:Abca13 APN 11 9399470 splice site probably benign
IGL01307:Abca13 APN 11 9297159 missense possibly damaging 0.86
IGL01349:Abca13 APN 11 9292076 missense probably benign 0.05
IGL01351:Abca13 APN 11 9267565 missense probably benign 0.28
IGL01446:Abca13 APN 11 9403834 missense probably damaging 0.97
IGL01453:Abca13 APN 11 9403834 missense probably damaging 0.97
IGL01461:Abca13 APN 11 9403834 missense probably damaging 0.97
IGL01476:Abca13 APN 11 9403834 missense probably damaging 0.97
IGL01506:Abca13 APN 11 9297447 missense probably benign 0.36
IGL01527:Abca13 APN 11 9290788 missense possibly damaging 0.49
IGL01559:Abca13 APN 11 9309020 missense possibly damaging 0.82
IGL01580:Abca13 APN 11 9293527 missense probably benign 0.00
IGL01679:Abca13 APN 11 9298071 missense probably benign 0.07
IGL01731:Abca13 APN 11 9249749 splice site probably benign
IGL01762:Abca13 APN 11 9315423 missense probably benign 0.18
IGL01781:Abca13 APN 11 9399280 missense probably damaging 1.00
IGL01802:Abca13 APN 11 9292438 missense probably benign 0.00
IGL01809:Abca13 APN 11 9290339 missense probably damaging 0.96
IGL01906:Abca13 APN 11 9216225 missense probably damaging 1.00
IGL01928:Abca13 APN 11 9683342 missense probably benign 0.13
IGL01940:Abca13 APN 11 9567661 splice site probably benign
IGL01993:Abca13 APN 11 9258452 unclassified probably benign
IGL02039:Abca13 APN 11 9297193 nonsense probably null
IGL02159:Abca13 APN 11 9314545 missense probably benign 0.00
IGL02202:Abca13 APN 11 9288529 missense possibly damaging 0.55
IGL02268:Abca13 APN 11 9290626 missense probably benign 0.00
IGL02332:Abca13 APN 11 9291482 missense probably damaging 0.98
IGL02380:Abca13 APN 11 9291599 missense possibly damaging 0.73
IGL02466:Abca13 APN 11 9297527 missense probably benign 0.00
IGL02505:Abca13 APN 11 9581498 missense probably damaging 1.00
IGL02507:Abca13 APN 11 9399388 missense probably damaging 1.00
IGL02558:Abca13 APN 11 9399387 missense probably damaging 1.00
IGL02581:Abca13 APN 11 9399132 splice site probably benign
IGL02586:Abca13 APN 11 9293983 missense possibly damaging 0.56
IGL02598:Abca13 APN 11 9431898 missense probably damaging 1.00
IGL02747:Abca13 APN 11 9373282 nonsense probably null
IGL02893:Abca13 APN 11 9290543 missense probably damaging 0.96
IGL02930:Abca13 APN 11 9378226 missense possibly damaging 0.86
IGL02967:Abca13 APN 11 9378291 missense probably damaging 0.99
IGL02983:Abca13 APN 11 9290663 missense probably benign 0.40
IGL02999:Abca13 APN 11 9581757 splice site probably benign
IGL03100:Abca13 APN 11 9258527 missense probably benign 0.25
IGL03114:Abca13 APN 11 9528999 missense probably benign 0.06
IGL03230:Abca13 APN 11 9294313 missense probably benign 0.02
IGL03329:Abca13 APN 11 9298047 missense probably benign 0.08
IGL03380:Abca13 APN 11 9298574 missense probably benign 0.10
IGL02835:Abca13 UTSW 11 9451515 missense probably damaging 1.00
R0017:Abca13 UTSW 11 9292775 missense probably damaging 0.99
R0079:Abca13 UTSW 11 9293493 missense probably benign 0.00
R0089:Abca13 UTSW 11 9292886 missense possibly damaging 0.76
R0103:Abca13 UTSW 11 9273951 missense probably damaging 1.00
R0103:Abca13 UTSW 11 9273951 missense probably damaging 1.00
R0113:Abca13 UTSW 11 9292114 missense possibly damaging 0.54
R0119:Abca13 UTSW 11 9298076 missense probably benign 0.03
R0152:Abca13 UTSW 11 9581724 missense probably damaging 0.98
R0255:Abca13 UTSW 11 9581545 missense probably damaging 1.00
R0277:Abca13 UTSW 11 9294701 missense probably benign 0.25
R0278:Abca13 UTSW 11 9378215 missense probably damaging 1.00
R0294:Abca13 UTSW 11 9269122 splice site probably null
R0299:Abca13 UTSW 11 9298076 missense probably benign 0.03
R0310:Abca13 UTSW 11 9293810 missense probably benign 0.36
R0317:Abca13 UTSW 11 9293459 missense probably damaging 1.00
R0323:Abca13 UTSW 11 9294701 missense probably benign 0.25
R0324:Abca13 UTSW 11 9297669 missense possibly damaging 0.76
R0329:Abca13 UTSW 11 9399430 missense probably damaging 0.97
R0336:Abca13 UTSW 11 9298481 missense probably benign 0.04
R0346:Abca13 UTSW 11 9566278 missense probably damaging 0.99
R0380:Abca13 UTSW 11 9588500 splice site probably null
R0382:Abca13 UTSW 11 9636650 splice site probably benign
R0482:Abca13 UTSW 11 9328207 missense possibly damaging 0.88
R0487:Abca13 UTSW 11 9331687 missense probably benign 0.07
R0491:Abca13 UTSW 11 9298235 missense probably benign 0.02
R0496:Abca13 UTSW 11 9291701 missense probably benign 0.01
R0505:Abca13 UTSW 11 9291058 missense probably benign 0.00
R0511:Abca13 UTSW 11 9294559 missense probably benign
R0525:Abca13 UTSW 11 9293371 missense probably damaging 1.00
R0538:Abca13 UTSW 11 9267622 critical splice donor site probably null
R0615:Abca13 UTSW 11 9256197 missense probably damaging 0.96
R0634:Abca13 UTSW 11 9314491 missense possibly damaging 0.59
R0699:Abca13 UTSW 11 9588508 splice site probably benign
R0848:Abca13 UTSW 11 9682011 nonsense probably null
R0883:Abca13 UTSW 11 9291238 nonsense probably null
R0892:Abca13 UTSW 11 9298305 missense probably benign 0.00
R0904:Abca13 UTSW 11 9298740 missense probably benign 0.22
R0968:Abca13 UTSW 11 9298016 missense probably benign 0.00
R1187:Abca13 UTSW 11 9528981 missense probably benign 0.00
R1299:Abca13 UTSW 11 9294821 missense possibly damaging 0.94
R1323:Abca13 UTSW 11 9290937 missense possibly damaging 0.86
R1323:Abca13 UTSW 11 9290937 missense possibly damaging 0.86
R1368:Abca13 UTSW 11 9291836 missense probably benign
R1387:Abca13 UTSW 11 9682085 nonsense probably null
R1436:Abca13 UTSW 11 9292646 missense probably damaging 0.99
R1449:Abca13 UTSW 11 9298580 missense probably damaging 1.00
R1450:Abca13 UTSW 11 9430531 splice site probably benign
R1462:Abca13 UTSW 11 9483924 splice site probably benign
R1465:Abca13 UTSW 11 9399303 missense probably damaging 1.00
R1465:Abca13 UTSW 11 9399303 missense probably damaging 1.00
R1466:Abca13 UTSW 11 9570536 splice site probably benign
R1494:Abca13 UTSW 11 9466429 nonsense probably null
R1559:Abca13 UTSW 11 9399180 missense probably null 1.00
R1564:Abca13 UTSW 11 9434316 nonsense probably null
R1698:Abca13 UTSW 11 9314507 missense probably benign 0.13
R1728:Abca13 UTSW 11 9249680 missense probably benign 0.02
R1734:Abca13 UTSW 11 9585460 missense probably benign 0.03
R1781:Abca13 UTSW 11 9269194 missense probably damaging 1.00
R1782:Abca13 UTSW 11 9297971 missense probably benign 0.36
R1807:Abca13 UTSW 11 9291755 missense probably damaging 0.98
R1830:Abca13 UTSW 11 9290350 missense probably benign 0.04
R1869:Abca13 UTSW 11 9292134 missense probably benign 0.19
R1870:Abca13 UTSW 11 9292134 missense probably benign 0.19
R1871:Abca13 UTSW 11 9292134 missense probably benign 0.19
R1903:Abca13 UTSW 11 9466411 missense probably benign 0.13
R1916:Abca13 UTSW 11 9534456 missense probably damaging 1.00
R1936:Abca13 UTSW 11 9293595 missense probably benign 0.13
R1976:Abca13 UTSW 11 9397815 missense probably damaging 1.00
R2001:Abca13 UTSW 11 9273967 missense probably benign 0.01
R2007:Abca13 UTSW 11 9191987 missense probably benign 0.19
R2016:Abca13 UTSW 11 9290619 missense probably damaging 1.00
R2017:Abca13 UTSW 11 9290619 missense probably damaging 1.00
R2034:Abca13 UTSW 11 9292628 missense possibly damaging 0.83
R2051:Abca13 UTSW 11 9328098 missense probably benign 0.04
R2075:Abca13 UTSW 11 9522382 missense probably damaging 1.00
R2118:Abca13 UTSW 11 9309013 splice site probably benign
R2120:Abca13 UTSW 11 9309013 splice site probably benign
R2124:Abca13 UTSW 11 9309013 splice site probably benign
R2148:Abca13 UTSW 11 9615764 missense probably damaging 1.00
R2149:Abca13 UTSW 11 9267508 missense possibly damaging 0.68
R2167:Abca13 UTSW 11 9288532 missense probably benign 0.19
R2261:Abca13 UTSW 11 9292288 missense probably benign
R2263:Abca13 UTSW 11 9274702 missense probably benign 0.04
R2281:Abca13 UTSW 11 9328136 missense probably damaging 0.98
R2340:Abca13 UTSW 11 9399165 missense probably damaging 0.99
R2357:Abca13 UTSW 11 9297336 missense probably damaging 1.00
R2370:Abca13 UTSW 11 9256185 missense possibly damaging 0.85
R2384:Abca13 UTSW 11 9267450 splice site probably benign
R2393:Abca13 UTSW 11 9275057 nonsense probably null
R2432:Abca13 UTSW 11 9451333 splice site probably benign
R2446:Abca13 UTSW 11 9275101 missense probably benign
R2568:Abca13 UTSW 11 9333310 missense probably benign 0.40
R2847:Abca13 UTSW 11 9294584 missense possibly damaging 0.59
R2860:Abca13 UTSW 11 9309057 missense probably damaging 0.99
R2861:Abca13 UTSW 11 9309057 missense probably damaging 0.99
R2862:Abca13 UTSW 11 9309057 missense probably damaging 0.99
R2877:Abca13 UTSW 11 9291889 missense possibly damaging 0.91
R2878:Abca13 UTSW 11 9291889 missense possibly damaging 0.91
R3748:Abca13 UTSW 11 9316119 splice site probably benign
R3789:Abca13 UTSW 11 9510668 missense probably damaging 0.97
R3933:Abca13 UTSW 11 9354856 missense probably damaging 1.00
R3981:Abca13 UTSW 11 9532407 missense probably benign
R4002:Abca13 UTSW 11 9585415 missense probably benign 0.00
R4010:Abca13 UTSW 11 9622013 splice site probably benign
R4011:Abca13 UTSW 11 9622013 splice site probably benign
R4127:Abca13 UTSW 11 9191973 missense probably benign 0.00
R4214:Abca13 UTSW 11 9293877 missense probably damaging 0.96
R4236:Abca13 UTSW 11 9256205 missense probably damaging 1.00
R4237:Abca13 UTSW 11 9434188 missense probably benign 0.01
R4359:Abca13 UTSW 11 9297629 missense probably benign 0.02
R4378:Abca13 UTSW 11 9293644 missense probably benign 0.00
R4389:Abca13 UTSW 11 9297878 missense probably damaging 0.98
R4392:Abca13 UTSW 11 9309034 missense possibly damaging 0.94
R4623:Abca13 UTSW 11 9309130 missense probably damaging 1.00
R4684:Abca13 UTSW 11 9434193 nonsense probably null
R4691:Abca13 UTSW 11 9434195 missense probably damaging 1.00
R4700:Abca13 UTSW 11 9292306 missense possibly damaging 0.59
R4701:Abca13 UTSW 11 9292306 missense possibly damaging 0.59
R4704:Abca13 UTSW 11 9276990 missense possibly damaging 0.94
R4751:Abca13 UTSW 11 9277973 critical splice donor site probably null
R4772:Abca13 UTSW 11 9315339 splice site probably null
R4782:Abca13 UTSW 11 9328096 missense probably damaging 0.96
R4801:Abca13 UTSW 11 9522341 missense possibly damaging 0.94
R4802:Abca13 UTSW 11 9522341 missense possibly damaging 0.94
R4819:Abca13 UTSW 11 9290421 missense possibly damaging 0.88
R4831:Abca13 UTSW 11 9542077 nonsense probably null
R4851:Abca13 UTSW 11 9483890 missense probably benign 0.02
R4857:Abca13 UTSW 11 9294143 missense probably benign 0.22
R4869:Abca13 UTSW 11 9315434 splice site probably null
R4982:Abca13 UTSW 11 9292348 missense possibly damaging 0.58
R5031:Abca13 UTSW 11 9297678 missense probably damaging 0.99
R5044:Abca13 UTSW 11 9373323 missense possibly damaging 0.80
R5092:Abca13 UTSW 11 9258535 missense probably damaging 1.00
R5155:Abca13 UTSW 11 9532447 missense probably damaging 0.98
R5173:Abca13 UTSW 11 9682032 frame shift probably null
R5180:Abca13 UTSW 11 9466510 missense probably benign 0.01
R5244:Abca13 UTSW 11 9275081 missense probably benign 0.28
R5257:Abca13 UTSW 11 9249684 missense possibly damaging 0.94
R5258:Abca13 UTSW 11 9249684 missense possibly damaging 0.94
R5299:Abca13 UTSW 11 9431861 missense probably damaging 1.00
R5363:Abca13 UTSW 11 9277035 missense possibly damaging 0.75
R5365:Abca13 UTSW 11 9628629 missense probably damaging 1.00
R5419:Abca13 UTSW 11 9193533 critical splice donor site probably null
R5426:Abca13 UTSW 11 9290722 missense probably damaging 1.00
R5468:Abca13 UTSW 11 9294062 missense probably damaging 1.00
R5477:Abca13 UTSW 11 9301298 missense possibly damaging 0.49
R5541:Abca13 UTSW 11 9291545 missense probably benign 0.00
R5553:Abca13 UTSW 11 9328158 missense probably damaging 1.00
R5556:Abca13 UTSW 11 9258546 missense possibly damaging 0.91
R5566:Abca13 UTSW 11 9294615 nonsense probably null
R5582:Abca13 UTSW 11 9636639 splice site probably null
R5604:Abca13 UTSW 11 9566279 missense probably damaging 0.97
R5609:Abca13 UTSW 11 9403874 missense probably benign 0.01
R5617:Abca13 UTSW 11 9277891 missense probably benign 0.00
R5693:Abca13 UTSW 11 9316233 missense probably benign 0.29
R5707:Abca13 UTSW 11 9510620 missense probably damaging 1.00
R5725:Abca13 UTSW 11 9577181 missense probably benign 0.00
R5728:Abca13 UTSW 11 9570576 missense probably damaging 1.00
R5738:Abca13 UTSW 11 9621917 missense probably damaging 1.00
R5758:Abca13 UTSW 11 9314536 missense probably damaging 0.97
R5762:Abca13 UTSW 11 9581665 missense probably damaging 1.00
R5771:Abca13 UTSW 11 9291411 missense probably damaging 1.00
R5809:Abca13 UTSW 11 9293692 missense probably damaging 1.00
R5826:Abca13 UTSW 11 9682056 missense probably damaging 0.99
R5831:Abca13 UTSW 11 9567777 nonsense probably null
R5834:Abca13 UTSW 11 9277974 critical splice donor site probably null
R5902:Abca13 UTSW 11 9297177 missense probably damaging 1.00
R5933:Abca13 UTSW 11 9249658 missense possibly damaging 0.63
R5945:Abca13 UTSW 11 9293398 missense probably benign 0.04
R5969:Abca13 UTSW 11 9292214 nonsense probably null
R5985:Abca13 UTSW 11 9291628 missense probably benign 0.02
R5998:Abca13 UTSW 11 9567708 missense probably damaging 0.97
R6021:Abca13 UTSW 11 9290465 nonsense probably null
R6022:Abca13 UTSW 11 9290759 missense probably damaging 1.00
R6032:Abca13 UTSW 11 9297752 missense possibly damaging 0.52
R6032:Abca13 UTSW 11 9297752 missense possibly damaging 0.52
R6105:Abca13 UTSW 11 9397812 missense probably damaging 1.00
R6153:Abca13 UTSW 11 9301259 critical splice acceptor site probably null
R6162:Abca13 UTSW 11 9309047 missense probably damaging 1.00
R6187:Abca13 UTSW 11 9309085 missense probably damaging 1.00
R6247:Abca13 UTSW 11 9403874 missense probably benign 0.01
R6329:Abca13 UTSW 11 9277937 missense probably damaging 1.00
R6352:Abca13 UTSW 11 9309139 splice site probably null
R6367:Abca13 UTSW 11 9216248 missense possibly damaging 0.85
R6423:Abca13 UTSW 11 9298778 missense probably benign 0.01
R6424:Abca13 UTSW 11 9510542 missense probably benign
R6456:Abca13 UTSW 11 9290474 missense possibly damaging 0.94
R6490:Abca13 UTSW 11 9298661 missense probably benign 0.00
R6547:Abca13 UTSW 11 9274757 missense probably benign 0.04
R6594:Abca13 UTSW 11 9294632 missense possibly damaging 0.52
R6604:Abca13 UTSW 11 9378384 missense probably damaging 1.00
R6614:Abca13 UTSW 11 9294371 missense probably benign 0.04
R6736:Abca13 UTSW 11 9465058 missense probably damaging 1.00
R6742:Abca13 UTSW 11 9328168 missense probably damaging 1.00
R6791:Abca13 UTSW 11 9378504 missense probably damaging 1.00
R6834:Abca13 UTSW 11 9275110 missense possibly damaging 0.48
R6936:Abca13 UTSW 11 9298568 missense probably damaging 0.96
R6955:Abca13 UTSW 11 9294307 missense probably benign 0.28
X0013:Abca13 UTSW 11 9273899 missense probably benign 0.02
X0057:Abca13 UTSW 11 9294744 missense probably damaging 0.96
X0066:Abca13 UTSW 11 9267565 missense probably damaging 0.96
Z1088:Abca13 UTSW 11 9294687 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- CTTTACCTTGCAGGGACTTTG -3'
(R):5'- AGAGTTACGTGGTGGGCATC -3'

Sequencing Primer
(F):5'- TGGAGGCCCCAAGAAATGTC -3'
(R):5'- CTGTCACTTTCACCTTTGGAAATGGG -3'
Posted On2014-10-01