Incidental Mutation 'R2158:Pde4dip'
ID234972
Institutional Source Beutler Lab
Gene Symbol Pde4dip
Ensembl Gene ENSMUSG00000038170
Gene Namephosphodiesterase 4D interacting protein (myomegalin)
SynonymsD130016K21Rik, Usmg4, 4732458A06Rik, D3Bwg1078e, 9430063L05Rik
MMRRC Submission 040161-MU
Accession Numbers

Genbank:NM_001039376.2, NM_001110163.1, NM_178080.4, NM_177145.3; MGI: 1891434; Ensembl: ENSMUST00000045243, ENSMUST00000090750, ENSMUST00000107038, ENSMUST00000163531, ENSMUST00000168438

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R2158 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location97689824-97888707 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 97757621 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Serine at position 333 (C333S)
Ref Sequence ENSEMBL: ENSMUSP00000102653 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045243] [ENSMUST00000090750] [ENSMUST00000107038] [ENSMUST00000168438] [ENSMUST00000175751]
Predicted Effect probably benign
Transcript: ENSMUST00000045243
AA Change: C430S

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000040905
Gene: ENSMUSG00000038170
AA Change: C430S

DomainStartEndE-ValueType
low complexity region 72 90 N/A INTRINSIC
low complexity region 159 170 N/A INTRINSIC
coiled coil region 399 451 N/A INTRINSIC
SCOP:d1gw5a_ 613 839 3e-3 SMART
coiled coil region 909 985 N/A INTRINSIC
low complexity region 1081 1099 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000090750
AA Change: C387S

PolyPhen 2 Score 0.016 (Sensitivity: 0.95; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000088254
Gene: ENSMUSG00000038170
AA Change: C387S

DomainStartEndE-ValueType
low complexity region 10 40 N/A INTRINSIC
low complexity region 45 57 N/A INTRINSIC
Pfam:Cnn_1N 124 196 3.2e-26 PFAM
low complexity region 204 219 N/A INTRINSIC
coiled coil region 282 325 N/A INTRINSIC
internal_repeat_1 397 438 4.03e-5 PROSPERO
low complexity region 567 578 N/A INTRINSIC
internal_repeat_2 617 667 6.59e-5 PROSPERO
internal_repeat_1 620 661 4.03e-5 PROSPERO
coiled coil region 866 942 N/A INTRINSIC
low complexity region 1038 1056 N/A INTRINSIC
low complexity region 1067 1082 N/A INTRINSIC
coiled coil region 1118 1163 N/A INTRINSIC
coiled coil region 1336 1363 N/A INTRINSIC
low complexity region 1403 1420 N/A INTRINSIC
coiled coil region 1470 1508 N/A INTRINSIC
internal_repeat_2 1597 1644 6.59e-5 PROSPERO
DUF1220 1680 1747 1.17e-17 SMART
low complexity region 1758 1780 N/A INTRINSIC
low complexity region 1836 1851 N/A INTRINSIC
low complexity region 1860 1874 N/A INTRINSIC
low complexity region 1940 1951 N/A INTRINSIC
coiled coil region 1962 2138 N/A INTRINSIC
coiled coil region 2162 2197 N/A INTRINSIC
coiled coil region 2387 2431 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000107038
AA Change: C333S

PolyPhen 2 Score 0.149 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000102653
Gene: ENSMUSG00000038170
AA Change: C333S

DomainStartEndE-ValueType
Pfam:Microtub_assoc 70 144 7.8e-32 PFAM
low complexity region 150 165 N/A INTRINSIC
coiled coil region 228 271 N/A INTRINSIC
internal_repeat_1 343 384 5.54e-5 PROSPERO
low complexity region 513 524 N/A INTRINSIC
internal_repeat_1 566 607 5.54e-5 PROSPERO
Predicted Effect probably benign
Transcript: ENSMUST00000168438
AA Change: C387S

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000131170
Gene: ENSMUSG00000038170
AA Change: C387S

DomainStartEndE-ValueType
low complexity region 10 40 N/A INTRINSIC
low complexity region 45 57 N/A INTRINSIC
Pfam:Microtub_assoc 124 198 1.4e-31 PFAM
low complexity region 204 219 N/A INTRINSIC
coiled coil region 282 325 N/A INTRINSIC
internal_repeat_1 397 438 3.56e-5 PROSPERO
low complexity region 567 578 N/A INTRINSIC
internal_repeat_2 617 667 5.83e-5 PROSPERO
internal_repeat_1 620 661 3.56e-5 PROSPERO
coiled coil region 866 942 N/A INTRINSIC
low complexity region 1038 1056 N/A INTRINSIC
low complexity region 1067 1082 N/A INTRINSIC
coiled coil region 1118 1163 N/A INTRINSIC
coiled coil region 1336 1363 N/A INTRINSIC
low complexity region 1403 1420 N/A INTRINSIC
coiled coil region 1470 1508 N/A INTRINSIC
internal_repeat_2 1597 1644 5.83e-5 PROSPERO
DUF1220 1680 1747 1.17e-17 SMART
low complexity region 1758 1769 N/A INTRINSIC
low complexity region 1785 1800 N/A INTRINSIC
low complexity region 1809 1823 N/A INTRINSIC
low complexity region 1889 1900 N/A INTRINSIC
coiled coil region 1911 2087 N/A INTRINSIC
coiled coil region 2111 2146 N/A INTRINSIC
coiled coil region 2336 2380 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000175751
AA Change: C430S

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000134832
Gene: ENSMUSG00000038170
AA Change: C430S

DomainStartEndE-ValueType
Pfam:zf-AD 4 78 4.3e-8 PFAM
low complexity region 159 170 N/A INTRINSIC
coiled coil region 399 451 N/A INTRINSIC
coiled coil region 513 538 N/A INTRINSIC
Meta Mutation Damage Score 0.232 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.6%
  • 20x: 96.0%
Validation Efficiency 100% (59/59)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene serves to anchor phosphodiesterase 4D to the Golgi/centrosome region of the cell. Defects in this gene may be a cause of myeloproliferative disorder (MBD) associated with eosinophilia. Several transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Aug 2010]
PHENOTYPE: Mice homozygous for a null allele exhibit partial (in utero or perinatal) lethality, hyperactivity, and increased vertical activity. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810055G02Rik T C 19: 3,716,608 V65A possibly damaging Het
4930402F06Rik A T 2: 35,385,668 S38T possibly damaging Het
Adam4 A G 12: 81,421,763 L28S probably damaging Het
Agmo T A 12: 37,357,710 F198I probably damaging Het
Akap7 A G 10: 25,171,164 V45A probably damaging Het
Amotl1 G T 9: 14,575,169 N476K probably benign Het
Apcs A G 1: 172,894,533 L82P probably damaging Het
Armc3 C A 2: 19,248,633 P195Q probably damaging Het
Astn2 A T 4: 66,404,254 L36Q unknown Het
Atad2 A T 15: 58,098,566 S870T possibly damaging Het
Bmp10 A T 6: 87,434,080 D285V probably benign Het
Caskin1 T C 17: 24,505,154 V972A probably benign Het
Ccdc141 T A 2: 77,030,671 N921Y probably damaging Het
Cntnap5b A T 1: 100,390,572 D1019V probably damaging Het
Eml5 T C 12: 98,843,946 probably benign Het
Evi5l T C 8: 4,193,195 Y360H probably damaging Het
Ewsr1 A G 11: 5,091,450 probably benign Het
Fn3k A T 11: 121,448,886 N158I probably damaging Het
Galnt17 C T 5: 130,906,702 R381Q probably damaging Het
Golga3 A T 5: 110,187,361 K180N probably damaging Het
Hipk1 A G 3: 103,760,538 L571P probably damaging Het
Hormad2 T A 11: 4,424,808 K69* probably null Het
Hspg2 A T 4: 137,517,604 D880V probably damaging Het
Ido2 T A 8: 24,540,636 D226V probably damaging Het
Irs3 A G 5: 137,644,699 F159S probably damaging Het
Itgb1bp1 T C 12: 21,276,859 T38A probably damaging Het
Kif11 A G 19: 37,410,614 I749V probably benign Het
Lrp1b T G 2: 40,879,555 M2811L probably benign Het
Lysmd3 A G 13: 81,669,618 Y238C probably damaging Het
Mapk11 G A 15: 89,146,372 T106M probably damaging Het
Mdga2 C T 12: 66,689,381 V358I possibly damaging Het
Muc4 C T 16: 32,754,563 T1479I probably benign Het
Myom1 T C 17: 71,064,597 V578A possibly damaging Het
Nek10 T G 14: 14,885,047 probably null Het
Nid2 G A 14: 19,778,043 G516S probably benign Het
Olfr328 T A 11: 58,551,942 Q99L probably damaging Het
Olfr620 G C 7: 103,612,236 T39R possibly damaging Het
Olfr645 T G 7: 104,084,826 T85P probably benign Het
Olfr69 G T 7: 103,767,961 C145* probably null Het
Olfr728 T A 14: 50,140,123 N172I probably damaging Het
Olfr930 T C 9: 38,930,579 M136T probably damaging Het
Pglyrp2 T A 17: 32,418,248 I269F probably benign Het
Plch1 A G 3: 63,721,234 V536A probably benign Het
Popdc2 T A 16: 38,362,826 L57Q probably damaging Het
Pramef17 T C 4: 143,994,315 R19G possibly damaging Het
Riox1 A G 12: 83,950,935 K82E probably benign Het
Rnasel G A 1: 153,754,901 V388M probably damaging Het
Smc1b A G 15: 85,121,851 probably benign Het
Snx25 A G 8: 46,041,407 S814P probably damaging Het
Spta1 A T 1: 174,229,258 H1859L probably benign Het
Strc T C 2: 121,365,862 I1562V probably benign Het
Taar5 T A 10: 23,971,088 I128N probably damaging Het
Ttc28 C T 5: 111,177,617 probably benign Het
Vcan A T 13: 89,703,529 M1104K possibly damaging Het
Vnn1 C T 10: 23,900,755 Q335* probably null Het
Zic1 T C 9: 91,364,893 D42G possibly damaging Het
Other mutations in Pde4dip
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00332:Pde4dip APN 3 97767277 missense probably benign 0.00
IGL00543:Pde4dip APN 3 97757624 missense possibly damaging 0.91
IGL00979:Pde4dip APN 3 97747758 splice site probably benign
IGL01483:Pde4dip APN 3 97754149 missense probably damaging 1.00
IGL02122:Pde4dip APN 3 97767421 missense probably damaging 1.00
IGL02398:Pde4dip APN 3 97766781 missense probably benign
IGL02814:Pde4dip APN 3 97767100 missense probably damaging 1.00
IGL02826:Pde4dip APN 3 97767087 missense probably damaging 1.00
D3080:Pde4dip UTSW 3 97766830 missense probably damaging 1.00
R0077:Pde4dip UTSW 3 97753126 nonsense probably null
R0096:Pde4dip UTSW 3 97767467 missense probably damaging 0.99
R0277:Pde4dip UTSW 3 97843712 missense probably benign 0.01
R0304:Pde4dip UTSW 3 97843712 missense probably benign 0.01
R0616:Pde4dip UTSW 3 97747533 missense probably benign 0.09
R0676:Pde4dip UTSW 3 97717097 splice site probably benign
R1166:Pde4dip UTSW 3 97713196 missense possibly damaging 0.94
R1376:Pde4dip UTSW 3 97743217 missense probably damaging 0.99
R1376:Pde4dip UTSW 3 97743217 missense probably damaging 0.99
R1452:Pde4dip UTSW 3 97724102 missense probably damaging 1.00
R1550:Pde4dip UTSW 3 97719704 missense probably damaging 1.00
R1700:Pde4dip UTSW 3 97703323 missense probably benign 0.00
R1704:Pde4dip UTSW 3 97754260 missense probably benign 0.28
R1769:Pde4dip UTSW 3 97695930 missense probably benign 0.00
R1934:Pde4dip UTSW 3 97692691 missense possibly damaging 0.74
R1980:Pde4dip UTSW 3 97756996 missense possibly damaging 0.93
R2088:Pde4dip UTSW 3 97754433 missense probably null 1.00
R2143:Pde4dip UTSW 3 97888519 missense possibly damaging 0.86
R2149:Pde4dip UTSW 3 97792836 missense possibly damaging 0.64
R2156:Pde4dip UTSW 3 97724218 missense probably damaging 0.98
R2240:Pde4dip UTSW 3 97724164 missense probably benign 0.00
R2249:Pde4dip UTSW 3 97793525 missense probably damaging 1.00
R2256:Pde4dip UTSW 3 97718184 missense probably damaging 1.00
R2680:Pde4dip UTSW 3 97701617 missense possibly damaging 0.92
R2921:Pde4dip UTSW 3 97719569 missense probably benign
R3407:Pde4dip UTSW 3 97754468 missense probably damaging 1.00
R3736:Pde4dip UTSW 3 97724111 missense probably damaging 1.00
R3787:Pde4dip UTSW 3 97715552 missense possibly damaging 0.80
R3883:Pde4dip UTSW 3 97713188 missense probably damaging 1.00
R4437:Pde4dip UTSW 3 97766569 missense possibly damaging 0.52
R4528:Pde4dip UTSW 3 97717022 missense probably damaging 1.00
R4576:Pde4dip UTSW 3 97754249 missense probably damaging 1.00
R4600:Pde4dip UTSW 3 97695944 missense probably damaging 0.98
R4653:Pde4dip UTSW 3 97767338 missense probably damaging 0.99
R4678:Pde4dip UTSW 3 97695005 missense probably damaging 1.00
R4679:Pde4dip UTSW 3 97695005 missense probably damaging 1.00
R4688:Pde4dip UTSW 3 97843677 nonsense probably null
R4770:Pde4dip UTSW 3 97767084 missense probably damaging 1.00
R4841:Pde4dip UTSW 3 97793528 missense probably damaging 1.00
R4842:Pde4dip UTSW 3 97793528 missense probably damaging 1.00
R4899:Pde4dip UTSW 3 97709558 missense probably damaging 1.00
R4914:Pde4dip UTSW 3 97715328 missense probably benign 0.10
R4943:Pde4dip UTSW 3 97755511 missense probably damaging 0.99
R5131:Pde4dip UTSW 3 97709514 missense probably damaging 0.98
R5408:Pde4dip UTSW 3 97796736 missense probably benign 0.35
R5583:Pde4dip UTSW 3 97747576 missense possibly damaging 0.67
R5677:Pde4dip UTSW 3 97841648 nonsense probably null
R5689:Pde4dip UTSW 3 97692367 nonsense probably null
R5696:Pde4dip UTSW 3 97709490 missense probably damaging 1.00
R5860:Pde4dip UTSW 3 97724188 missense possibly damaging 0.68
R6279:Pde4dip UTSW 3 97699180 missense probably damaging 1.00
R6341:Pde4dip UTSW 3 97694911 missense probably benign
R6440:Pde4dip UTSW 3 97767586 missense probably damaging 1.00
R6464:Pde4dip UTSW 3 97710344 missense probably damaging 1.00
R6489:Pde4dip UTSW 3 97755591 nonsense probably null
R6706:Pde4dip UTSW 3 97741393 missense probably damaging 1.00
R6722:Pde4dip UTSW 3 97718239 nonsense probably null
R6798:Pde4dip UTSW 3 97888534 missense probably benign
R6804:Pde4dip UTSW 3 97793248 nonsense probably null
R6862:Pde4dip UTSW 3 97767024 missense possibly damaging 0.52
R6957:Pde4dip UTSW 3 97824333 splice site probably null
R6983:Pde4dip UTSW 3 97718236 missense probably damaging 1.00
R7014:Pde4dip UTSW 3 97715422 missense possibly damaging 0.54
R7025:Pde4dip UTSW 3 97724183 nonsense probably null
R7136:Pde4dip UTSW 3 97694063 missense probably benign 0.03
R7178:Pde4dip UTSW 3 97715630 missense probably benign 0.26
R7269:Pde4dip UTSW 3 97766959 missense probably damaging 1.00
R7283:Pde4dip UTSW 3 97758882 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- TTTGCTGGCCTGACAATAGTGAC -3'
(R):5'- AGGGAAGCAGTGCACATCTG -3'

Sequencing Primer
(F):5'- TGGCCTGACAATAGTGACATCTAC -3'
(R):5'- AGTGCACATCTGCTGCC -3'
Posted On2014-10-01