Incidental Mutation 'R2158:Zic1'
ID234990
Institutional Source Beutler Lab
Gene Symbol Zic1
Ensembl Gene ENSMUSG00000032368
Gene Namezinc finger protein of the cerebellum 1
Synonymsodd-paired homolog
MMRRC Submission 040161-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.941) question?
Stock #R2158 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location91358058-91365810 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 91364893 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 42 (D42G)
Ref Sequence ENSEMBL: ENSMUSP00000068858 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034927] [ENSMUST00000065360] [ENSMUST00000172646] [ENSMUST00000173054] [ENSMUST00000173342]
Predicted Effect possibly damaging
Transcript: ENSMUST00000034927
AA Change: D42G

PolyPhen 2 Score 0.732 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000034927
Gene: ENSMUSG00000032368
AA Change: D42G

DomainStartEndE-ValueType
low complexity region 68 85 N/A INTRINSIC
low complexity region 110 134 N/A INTRINSIC
ZnF_C2H2 238 260 6.82e1 SMART
ZnF_C2H2 269 296 7.49e0 SMART
ZnF_C2H2 302 326 8.02e-5 SMART
ZnF_C2H2 332 356 1.58e-3 SMART
ZnF_C2H2 362 384 4.54e-4 SMART
low complexity region 386 400 N/A INTRINSIC
low complexity region 403 427 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000065360
AA Change: D42G

PolyPhen 2 Score 0.732 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000068858
Gene: ENSMUSG00000032368
AA Change: D42G

DomainStartEndE-ValueType
low complexity region 68 85 N/A INTRINSIC
low complexity region 110 134 N/A INTRINSIC
ZnF_C2H2 238 260 6.82e1 SMART
ZnF_C2H2 269 296 7.49e0 SMART
ZnF_C2H2 302 326 8.02e-5 SMART
ZnF_C2H2 332 356 1.58e-3 SMART
ZnF_C2H2 362 384 4.54e-4 SMART
low complexity region 386 400 N/A INTRINSIC
low complexity region 403 427 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000170572
Predicted Effect probably benign
Transcript: ENSMUST00000172646
SMART Domains Protein: ENSMUSP00000134053
Gene: ENSMUSG00000036972

DomainStartEndE-ValueType
ZnF_C2H2 128 162 4.74e1 SMART
ZnF_C2H2 171 198 7.68e0 SMART
ZnF_C2H2 204 228 8.02e-5 SMART
ZnF_C2H2 234 258 7.15e-2 SMART
ZnF_C2H2 264 288 3.21e-4 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000172978
Predicted Effect probably benign
Transcript: ENSMUST00000173054
SMART Domains Protein: ENSMUSP00000134364
Gene: ENSMUSG00000036972

DomainStartEndE-ValueType
PDB:2EJ4|A 122 181 3e-16 PDB
Blast:ZnF_C2H2 128 151 5e-9 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173121
SMART Domains Protein: ENSMUSP00000134006
Gene: ENSMUSG00000032368

DomainStartEndE-ValueType
ZnF_C2H2 10 32 4.54e-4 SMART
low complexity region 34 48 N/A INTRINSIC
low complexity region 51 75 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000173342
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174611
Meta Mutation Damage Score 0.08 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.6%
  • 20x: 96.0%
Validation Efficiency 100% (59/59)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the ZIC family of C2H2-type zinc finger proteins. Members of this family are important during development. Aberrant expression of this gene is seen in medulloblastoma, a childhood brain tumor. This gene is closely linked to the gene encoding zinc finger protein of the cerebellum 4, a related family member on chromosome 3. This gene encodes a transcription factor that can bind and transactivate the apolipoprotein E gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutants show cerebellar hypoplasia with a missing lobule of the anterior lobe. Newborn pups suckle poorly. 50% die within one day of birth and almost all die within 3 weeks; longer survivors show marked ataxia and exhibit tonic convulsions. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810055G02Rik T C 19: 3,716,608 V65A possibly damaging Het
4930402F06Rik A T 2: 35,385,668 S38T possibly damaging Het
Adam4 A G 12: 81,421,763 L28S probably damaging Het
Agmo T A 12: 37,357,710 F198I probably damaging Het
Akap7 A G 10: 25,171,164 V45A probably damaging Het
Amotl1 G T 9: 14,575,169 N476K probably benign Het
Apcs A G 1: 172,894,533 L82P probably damaging Het
Armc3 C A 2: 19,248,633 P195Q probably damaging Het
Astn2 A T 4: 66,404,254 L36Q unknown Het
Atad2 A T 15: 58,098,566 S870T possibly damaging Het
Bmp10 A T 6: 87,434,080 D285V probably benign Het
Caskin1 T C 17: 24,505,154 V972A probably benign Het
Ccdc141 T A 2: 77,030,671 N921Y probably damaging Het
Cntnap5b A T 1: 100,390,572 D1019V probably damaging Het
Eml5 T C 12: 98,843,946 probably benign Het
Evi5l T C 8: 4,193,195 Y360H probably damaging Het
Ewsr1 A G 11: 5,091,450 probably benign Het
Fn3k A T 11: 121,448,886 N158I probably damaging Het
Galnt17 C T 5: 130,906,702 R381Q probably damaging Het
Golga3 A T 5: 110,187,361 K180N probably damaging Het
Hipk1 A G 3: 103,760,538 L571P probably damaging Het
Hormad2 T A 11: 4,424,808 K69* probably null Het
Hspg2 A T 4: 137,517,604 D880V probably damaging Het
Ido2 T A 8: 24,540,636 D226V probably damaging Het
Irs3 A G 5: 137,644,699 F159S probably damaging Het
Itgb1bp1 T C 12: 21,276,859 T38A probably damaging Het
Kif11 A G 19: 37,410,614 I749V probably benign Het
Lrp1b T G 2: 40,879,555 M2811L probably benign Het
Lysmd3 A G 13: 81,669,618 Y238C probably damaging Het
Mapk11 G A 15: 89,146,372 T106M probably damaging Het
Mdga2 C T 12: 66,689,381 V358I possibly damaging Het
Muc4 C T 16: 32,754,563 T1479I probably benign Het
Myom1 T C 17: 71,064,597 V578A possibly damaging Het
Nek10 T G 14: 14,885,047 probably null Het
Nid2 G A 14: 19,778,043 G516S probably benign Het
Olfr328 T A 11: 58,551,942 Q99L probably damaging Het
Olfr620 G C 7: 103,612,236 T39R possibly damaging Het
Olfr645 T G 7: 104,084,826 T85P probably benign Het
Olfr69 G T 7: 103,767,961 C145* probably null Het
Olfr728 T A 14: 50,140,123 N172I probably damaging Het
Olfr930 T C 9: 38,930,579 M136T probably damaging Het
Pde4dip A T 3: 97,757,621 C333S probably benign Het
Pglyrp2 T A 17: 32,418,248 I269F probably benign Het
Plch1 A G 3: 63,721,234 V536A probably benign Het
Popdc2 T A 16: 38,362,826 L57Q probably damaging Het
Pramef17 T C 4: 143,994,315 R19G possibly damaging Het
Riox1 A G 12: 83,950,935 K82E probably benign Het
Rnasel G A 1: 153,754,901 V388M probably damaging Het
Smc1b A G 15: 85,121,851 probably benign Het
Snx25 A G 8: 46,041,407 S814P probably damaging Het
Spta1 A T 1: 174,229,258 H1859L probably benign Het
Strc T C 2: 121,365,862 I1562V probably benign Het
Taar5 T A 10: 23,971,088 I128N probably damaging Het
Ttc28 C T 5: 111,177,617 probably benign Het
Vcan A T 13: 89,703,529 M1104K possibly damaging Het
Vnn1 C T 10: 23,900,755 Q335* probably null Het
Other mutations in Zic1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02022:Zic1 APN 9 91362472 utr 5 prime probably null
IGL02669:Zic1 APN 9 91364433 missense possibly damaging 0.71
IGL02968:Zic1 APN 9 91362490 missense probably damaging 1.00
PIT4812001:Zic1 UTSW 9 91364341 missense probably damaging 1.00
R1493:Zic1 UTSW 9 91364756 missense probably damaging 1.00
R1599:Zic1 UTSW 9 91361688 missense probably benign 0.08
R1742:Zic1 UTSW 9 91361576 missense probably damaging 0.98
R4587:Zic1 UTSW 9 91364822 missense probably damaging 1.00
R4735:Zic1 UTSW 9 91364505 missense possibly damaging 0.55
R4830:Zic1 UTSW 9 91362531 missense probably damaging 1.00
R5186:Zic1 UTSW 9 91364371 missense probably damaging 1.00
R5702:Zic1 UTSW 9 91364080 missense probably damaging 0.99
R6298:Zic1 UTSW 9 91364503 missense probably damaging 1.00
R7221:Zic1 UTSW 9 91364732 missense probably damaging 1.00
R7250:Zic1 UTSW 9 91364975 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GTCCCGGGTAGAATTGAAAGC -3'
(R):5'- CTGGCTGAGACTTCGTTAGG -3'

Sequencing Primer
(F):5'- TAGAATTGAAAGCAGCGCTGG -3'
(R):5'- TTAGGTGGGTCGACTCCCC -3'
Posted On2014-10-01