Incidental Mutation 'R0197:Arhgef10'
ID23501
Institutional Source Beutler Lab
Gene Symbol Arhgef10
Ensembl Gene ENSMUSG00000071176
Gene NameRho guanine nucleotide exchange factor (GEF) 10
Synonyms6430549H08Rik
MMRRC Submission 038456-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.192) question?
Stock #R0197 (G1)
Quality Score225
Status Validated
Chromosome8
Chromosomal Location14911663-15001085 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 14962636 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glutamic Acid at position 320 (V320E)
Ref Sequence ENSEMBL: ENSMUSP00000125526 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000084207] [ENSMUST00000110800] [ENSMUST00000161162] [ENSMUST00000163062]
Predicted Effect probably damaging
Transcript: ENSMUST00000084207
AA Change: V648E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000081225
Gene: ENSMUSG00000071176
AA Change: V648E

DomainStartEndE-ValueType
low complexity region 73 82 N/A INTRINSIC
low complexity region 155 165 N/A INTRINSIC
low complexity region 236 245 N/A INTRINSIC
low complexity region 247 265 N/A INTRINSIC
coiled coil region 308 335 N/A INTRINSIC
RhoGEF 401 583 9.79e-58 SMART
Blast:PH 617 829 6e-47 BLAST
low complexity region 1256 1272 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000110800
AA Change: V609E

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000106424
Gene: ENSMUSG00000071176
AA Change: V609E

DomainStartEndE-ValueType
low complexity region 73 82 N/A INTRINSIC
low complexity region 155 165 N/A INTRINSIC
low complexity region 236 245 N/A INTRINSIC
low complexity region 247 265 N/A INTRINSIC
low complexity region 280 291 N/A INTRINSIC
RhoGEF 362 544 9.79e-58 SMART
Blast:PH 578 790 8e-47 BLAST
low complexity region 1217 1233 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000161162
SMART Domains Protein: ENSMUSP00000125606
Gene: ENSMUSG00000071176

DomainStartEndE-ValueType
low complexity region 73 82 N/A INTRINSIC
low complexity region 155 165 N/A INTRINSIC
low complexity region 235 244 N/A INTRINSIC
low complexity region 246 264 N/A INTRINSIC
coiled coil region 307 334 N/A INTRINSIC
RhoGEF 400 579 2.2e-51 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162958
Predicted Effect probably damaging
Transcript: ENSMUST00000163062
AA Change: V320E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000125526
Gene: ENSMUSG00000071176
AA Change: V320E

DomainStartEndE-ValueType
RhoGEF 73 255 9.79e-58 SMART
Blast:PH 289 501 2e-47 BLAST
low complexity region 899 915 N/A INTRINSIC
Meta Mutation Damage Score 0.206 question?
Coding Region Coverage
  • 1x: 98.6%
  • 3x: 97.3%
  • 10x: 92.5%
  • 20x: 75.9%
Validation Efficiency 97% (121/125)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a Rho guanine nucleotide exchange factor (GEF). Rho GEFs regulate the activity of small Rho GTPases by stimulating the exchange of guanine diphosphate (GDP) for guanine triphosphate (GTP) and may play a role in neural morphogenesis. Mutations in this gene are associated with slowed nerve conduction velocity (SNCV). Alternative splicing results in multiple transcript variants. [provided by RefSeq, Apr 2015]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110002E22Rik T C 3: 138,069,871 L1607P probably damaging Het
1700016H13Rik T C 5: 103,648,821 *118W probably null Het
1700061G19Rik A T 17: 56,883,835 N468Y probably benign Het
2610507B11Rik A C 11: 78,269,704 probably benign Het
4930452B06Rik C T 14: 8,518,695 G254R probably damaging Het
Abcc2 A T 19: 43,826,614 R1147* probably null Het
Agap2 A G 10: 127,091,702 T1131A possibly damaging Het
Aldh9a1 A G 1: 167,361,847 D388G probably damaging Het
Ap3d1 G T 10: 80,730,042 A97E probably damaging Het
Baiap2l1 C A 5: 144,266,010 V498L probably damaging Het
Ccdc189 T C 7: 127,584,862 E261G probably damaging Het
Cdh2 T C 18: 16,629,576 N437S probably benign Het
Chd1 C A 17: 15,725,431 N72K probably benign Het
Col4a3bp T A 13: 96,549,287 Y63N probably benign Het
Cstf2t A T 19: 31,084,626 M521L probably benign Het
Dlx5 T C 6: 6,881,619 K90E possibly damaging Het
Dmp1 A G 5: 104,207,630 E32G possibly damaging Het
Espnl T G 1: 91,344,489 Y524D probably damaging Het
Fam20c T C 5: 138,755,724 L30P probably damaging Het
Fat1 G T 8: 45,026,553 A2879S probably benign Het
Gabrg1 A T 5: 70,774,389 V337D probably damaging Het
Gart C A 16: 91,623,403 D851Y possibly damaging Het
Gcc1 T C 6: 28,420,616 H234R probably damaging Het
Gemin6 T A 17: 80,228,095 H161Q probably damaging Het
Glt6d1 A G 2: 25,794,070 I308T probably benign Het
Gm10320 T C 13: 98,491,983 T7A probably benign Het
Gm10912 T C 2: 104,066,530 S5P probably benign Het
Gm13088 C T 4: 143,656,440 E70K possibly damaging Het
Gmpr2 T A 14: 55,672,735 D7E possibly damaging Het
Hc A G 2: 34,984,750 Y1620H probably damaging Het
Hoxa3 T C 6: 52,170,143 probably benign Het
Ift140 A G 17: 25,090,933 T1105A probably benign Het
Kdr G T 5: 75,968,422 T188N possibly damaging Het
Lepr A T 4: 101,752,152 D312V possibly damaging Het
Mcm3 A G 1: 20,810,105 V501A probably damaging Het
Mcur1 T C 13: 43,545,740 Y267C probably damaging Het
Med13 T A 11: 86,307,038 T736S probably benign Het
Med13l T C 5: 118,671,002 probably benign Het
Mroh2a G C 1: 88,246,042 A871P probably damaging Het
Ndrg2 T A 14: 51,907,003 probably benign Het
Oas3 G A 5: 120,756,145 R39C probably damaging Het
Olfr1258 A G 2: 89,930,201 T131A probably benign Het
Olfr1298 C T 2: 111,645,791 V69I probably benign Het
Olfr272 G A 4: 52,910,849 T315M probably benign Het
Olfr558 T A 7: 102,709,995 H245Q probably damaging Het
Onecut2 T A 18: 64,341,472 S365T possibly damaging Het
Pds5b C A 5: 150,754,431 Q505K probably benign Het
Rfx2 T C 17: 56,803,722 Y88C probably damaging Het
Rpl6 T C 5: 121,208,478 V214A probably benign Het
Samd3 T A 10: 26,271,854 C476S possibly damaging Het
Sfi1 TCGC TC 11: 3,146,254 probably null Het
Shank1 C T 7: 44,352,294 R1146W unknown Het
Smcr8 T C 11: 60,778,115 Y30H probably damaging Het
Smpd4 T A 16: 17,641,597 probably null Het
Strip1 C A 3: 107,614,613 D750Y probably damaging Het
Svep1 T C 4: 58,070,851 K2312E possibly damaging Het
Taf1c A T 8: 119,599,983 I438N probably damaging Het
Tnfaip1 A T 11: 78,530,014 probably benign Het
Unc45b T A 11: 82,940,205 L797Q possibly damaging Het
Usp24 T A 4: 106,407,133 W1754R probably damaging Het
Utp20 G A 10: 88,777,516 P1301L probably benign Het
Vmn2r115 T A 17: 23,359,781 S743T probably damaging Het
Vps41 T G 13: 18,854,663 probably null Het
Vps72 G T 3: 95,122,583 L304F probably damaging Het
Wiz A T 17: 32,356,441 I907N probably damaging Het
Zfp521 T C 18: 13,845,062 T765A probably benign Het
Zfp616 A T 11: 74,085,674 H923L probably damaging Het
Zp2 A T 7: 120,143,576 probably benign Het
Other mutations in Arhgef10
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00766:Arhgef10 APN 8 14975006 missense probably damaging 1.00
IGL00823:Arhgef10 APN 8 14940378 unclassified probably benign
IGL01012:Arhgef10 APN 8 14979977 missense probably damaging 0.99
IGL01311:Arhgef10 APN 8 14991054 splice site probably null
IGL01596:Arhgef10 APN 8 14999468 nonsense probably null
IGL01888:Arhgef10 APN 8 14962577 nonsense probably null
IGL01938:Arhgef10 APN 8 14991062 missense probably benign 0.09
IGL02151:Arhgef10 APN 8 14928889 missense possibly damaging 0.77
IGL02274:Arhgef10 APN 8 14947205 missense probably damaging 0.99
IGL02369:Arhgef10 APN 8 14997551 missense probably damaging 1.00
IGL02411:Arhgef10 APN 8 14954819 missense probably benign 0.01
IGL02500:Arhgef10 APN 8 14961238 missense probably damaging 1.00
IGL02597:Arhgef10 APN 8 14930198 missense probably benign 0.27
IGL02602:Arhgef10 APN 8 14930198 missense probably benign 0.27
IGL02743:Arhgef10 APN 8 14930198 missense probably benign 0.27
IGL02744:Arhgef10 APN 8 14930198 missense probably benign 0.27
IGL03113:Arhgef10 APN 8 14954505 missense probably damaging 1.00
IGL03248:Arhgef10 APN 8 14928847 missense probably benign 0.00
P0028:Arhgef10 UTSW 8 14928925 missense possibly damaging 0.79
P4748:Arhgef10 UTSW 8 14928925 missense possibly damaging 0.79
R0049:Arhgef10 UTSW 8 14954446 missense probably damaging 1.00
R0479:Arhgef10 UTSW 8 14991070 missense probably damaging 0.98
R0701:Arhgef10 UTSW 8 14962636 missense probably damaging 1.00
R0966:Arhgef10 UTSW 8 14940343 missense probably benign 0.01
R1367:Arhgef10 UTSW 8 14940225 missense probably damaging 1.00
R1572:Arhgef10 UTSW 8 14991211 missense possibly damaging 0.53
R1631:Arhgef10 UTSW 8 14947157 missense probably damaging 0.98
R1766:Arhgef10 UTSW 8 14979836 missense probably damaging 1.00
R1920:Arhgef10 UTSW 8 14956987 splice site probably benign
R2051:Arhgef10 UTSW 8 14945320 missense probably null 1.00
R2088:Arhgef10 UTSW 8 14983898 missense possibly damaging 0.46
R2118:Arhgef10 UTSW 8 14934820 missense probably damaging 0.99
R2120:Arhgef10 UTSW 8 14934820 missense probably damaging 0.99
R2121:Arhgef10 UTSW 8 14934820 missense probably damaging 0.99
R2122:Arhgef10 UTSW 8 14934820 missense probably damaging 0.99
R2124:Arhgef10 UTSW 8 14934820 missense probably damaging 0.99
R2318:Arhgef10 UTSW 8 14928855 missense probably damaging 1.00
R2870:Arhgef10 UTSW 8 14975093 critical splice donor site probably null
R2870:Arhgef10 UTSW 8 14975666 missense probably benign 0.01
R2870:Arhgef10 UTSW 8 14975093 critical splice donor site probably null
R2870:Arhgef10 UTSW 8 14975666 missense probably benign 0.01
R2872:Arhgef10 UTSW 8 14975093 critical splice donor site probably null
R2872:Arhgef10 UTSW 8 14975666 missense probably benign 0.01
R2872:Arhgef10 UTSW 8 14975093 critical splice donor site probably null
R2872:Arhgef10 UTSW 8 14975666 missense probably benign 0.01
R2874:Arhgef10 UTSW 8 14975093 critical splice donor site probably null
R2874:Arhgef10 UTSW 8 14975666 missense probably benign 0.01
R3522:Arhgef10 UTSW 8 14954918 missense probably damaging 1.00
R4049:Arhgef10 UTSW 8 14979998 missense probably benign 0.05
R4324:Arhgef10 UTSW 8 14940335 missense possibly damaging 0.77
R4351:Arhgef10 UTSW 8 14991145 nonsense probably null
R4384:Arhgef10 UTSW 8 14930157 nonsense probably null
R4385:Arhgef10 UTSW 8 14930157 nonsense probably null
R4685:Arhgef10 UTSW 8 14956963 missense probably damaging 1.00
R5111:Arhgef10 UTSW 8 14932408 missense probably benign 0.00
R5169:Arhgef10 UTSW 8 14930051 missense possibly damaging 0.80
R5670:Arhgef10 UTSW 8 14954774 missense probably benign 0.01
R5945:Arhgef10 UTSW 8 14980028 critical splice donor site probably null
R6592:Arhgef10 UTSW 8 14962522 missense probably damaging 1.00
R6592:Arhgef10 UTSW 8 14962564 missense possibly damaging 0.82
R6734:Arhgef10 UTSW 8 14975053 missense probably damaging 1.00
R6859:Arhgef10 UTSW 8 14975005 missense probably damaging 1.00
R6890:Arhgef10 UTSW 8 14928786 missense probably benign 0.27
X0024:Arhgef10 UTSW 8 14978486 missense probably benign 0.01
X0027:Arhgef10 UTSW 8 14997631 missense possibly damaging 0.92
Z1088:Arhgef10 UTSW 8 14964191 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- TTCTCCTTTGCGGAAACCTGAGTG -3'
(R):5'- AGCACCAGTCTTCCTGAGATCACC -3'

Sequencing Primer
(F):5'- AAACCTGAGTGGGTGACCTC -3'
(R):5'- ggtttcacccccagcac -3'
Posted On2013-04-16