Incidental Mutation 'R0197:Taf1c'
ID23503
Institutional Source Beutler Lab
Gene Symbol Taf1c
Ensembl Gene ENSMUSG00000031832
Gene NameTATA-box binding protein associated factor, RNA polymerase I, C
SynonymsmTAFI95
MMRRC Submission 038456-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.906) question?
Stock #R0197 (G1)
Quality Score225
Status Validated
Chromosome8
Chromosomal Location119597871-119605222 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 119599983 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 438 (I438N)
Ref Sequence ENSEMBL: ENSMUSP00000090789 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000093099] [ENSMUST00000093100] [ENSMUST00000147964]
Predicted Effect probably damaging
Transcript: ENSMUST00000093099
AA Change: I438N

PolyPhen 2 Score 0.976 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000090789
Gene: ENSMUSG00000031832
AA Change: I438N

DomainStartEndE-ValueType
low complexity region 60 79 N/A INTRINSIC
SCOP:d1k32a3 253 389 2e-3 SMART
Blast:WD40 301 340 2e-15 BLAST
low complexity region 457 472 N/A INTRINSIC
low complexity region 478 490 N/A INTRINSIC
low complexity region 520 535 N/A INTRINSIC
low complexity region 724 732 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000093100
SMART Domains Protein: ENSMUSP00000090790
Gene: ENSMUSG00000031831

DomainStartEndE-ValueType
Pfam:LRR_9 115 298 5.7e-10 PFAM
low complexity region 322 332 N/A INTRINSIC
low complexity region 482 501 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000117927
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126547
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131652
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144379
Predicted Effect probably benign
Transcript: ENSMUST00000147964
SMART Domains Protein: ENSMUSP00000118480
Gene: ENSMUSG00000031832

DomainStartEndE-ValueType
low complexity region 60 79 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212929
Meta Mutation Damage Score 0.0768 question?
Coding Region Coverage
  • 1x: 98.6%
  • 3x: 97.3%
  • 10x: 92.5%
  • 20x: 75.9%
Validation Efficiency 97% (121/125)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Initiation of transcription by RNA polymerase I requires the formation of a complex composed of the TATA-binding protein (TBP) and three TBP-associated factors (TAFs) specific for RNA polymerase I. This complex, known as SL1, binds to the core promoter of ribosomal RNA genes to position the polymerase properly and acts as a channel for regulatory signals. This gene encodes the largest SL1-specific TAF. Multiple alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Jul 2011]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110002E22Rik T C 3: 138,069,871 L1607P probably damaging Het
1700016H13Rik T C 5: 103,648,821 *118W probably null Het
1700061G19Rik A T 17: 56,883,835 N468Y probably benign Het
2610507B11Rik A C 11: 78,269,704 probably benign Het
4930452B06Rik C T 14: 8,518,695 G254R probably damaging Het
Abcc2 A T 19: 43,826,614 R1147* probably null Het
Agap2 A G 10: 127,091,702 T1131A possibly damaging Het
Aldh9a1 A G 1: 167,361,847 D388G probably damaging Het
Ap3d1 G T 10: 80,730,042 A97E probably damaging Het
Arhgef10 T A 8: 14,962,636 V320E probably damaging Het
Baiap2l1 C A 5: 144,266,010 V498L probably damaging Het
Ccdc189 T C 7: 127,584,862 E261G probably damaging Het
Cdh2 T C 18: 16,629,576 N437S probably benign Het
Chd1 C A 17: 15,725,431 N72K probably benign Het
Col4a3bp T A 13: 96,549,287 Y63N probably benign Het
Cstf2t A T 19: 31,084,626 M521L probably benign Het
Dlx5 T C 6: 6,881,619 K90E possibly damaging Het
Dmp1 A G 5: 104,207,630 E32G possibly damaging Het
Espnl T G 1: 91,344,489 Y524D probably damaging Het
Fam20c T C 5: 138,755,724 L30P probably damaging Het
Fat1 G T 8: 45,026,553 A2879S probably benign Het
Gabrg1 A T 5: 70,774,389 V337D probably damaging Het
Gart C A 16: 91,623,403 D851Y possibly damaging Het
Gcc1 T C 6: 28,420,616 H234R probably damaging Het
Gemin6 T A 17: 80,228,095 H161Q probably damaging Het
Glt6d1 A G 2: 25,794,070 I308T probably benign Het
Gm10320 T C 13: 98,491,983 T7A probably benign Het
Gm10912 T C 2: 104,066,530 S5P probably benign Het
Gm13088 C T 4: 143,656,440 E70K possibly damaging Het
Gmpr2 T A 14: 55,672,735 D7E possibly damaging Het
Hc A G 2: 34,984,750 Y1620H probably damaging Het
Hoxa3 T C 6: 52,170,143 probably benign Het
Ift140 A G 17: 25,090,933 T1105A probably benign Het
Kdr G T 5: 75,968,422 T188N possibly damaging Het
Lepr A T 4: 101,752,152 D312V possibly damaging Het
Mcm3 A G 1: 20,810,105 V501A probably damaging Het
Mcur1 T C 13: 43,545,740 Y267C probably damaging Het
Med13 T A 11: 86,307,038 T736S probably benign Het
Med13l T C 5: 118,671,002 probably benign Het
Mroh2a G C 1: 88,246,042 A871P probably damaging Het
Ndrg2 T A 14: 51,907,003 probably benign Het
Oas3 G A 5: 120,756,145 R39C probably damaging Het
Olfr1258 A G 2: 89,930,201 T131A probably benign Het
Olfr1298 C T 2: 111,645,791 V69I probably benign Het
Olfr272 G A 4: 52,910,849 T315M probably benign Het
Olfr558 T A 7: 102,709,995 H245Q probably damaging Het
Onecut2 T A 18: 64,341,472 S365T possibly damaging Het
Pds5b C A 5: 150,754,431 Q505K probably benign Het
Rfx2 T C 17: 56,803,722 Y88C probably damaging Het
Rpl6 T C 5: 121,208,478 V214A probably benign Het
Samd3 T A 10: 26,271,854 C476S possibly damaging Het
Sfi1 TCGC TC 11: 3,146,254 probably null Het
Shank1 C T 7: 44,352,294 R1146W unknown Het
Smcr8 T C 11: 60,778,115 Y30H probably damaging Het
Smpd4 T A 16: 17,641,597 probably null Het
Strip1 C A 3: 107,614,613 D750Y probably damaging Het
Svep1 T C 4: 58,070,851 K2312E possibly damaging Het
Tnfaip1 A T 11: 78,530,014 probably benign Het
Unc45b T A 11: 82,940,205 L797Q possibly damaging Het
Usp24 T A 4: 106,407,133 W1754R probably damaging Het
Utp20 G A 10: 88,777,516 P1301L probably benign Het
Vmn2r115 T A 17: 23,359,781 S743T probably damaging Het
Vps41 T G 13: 18,854,663 probably null Het
Vps72 G T 3: 95,122,583 L304F probably damaging Het
Wiz A T 17: 32,356,441 I907N probably damaging Het
Zfp521 T C 18: 13,845,062 T765A probably benign Het
Zfp616 A T 11: 74,085,674 H923L probably damaging Het
Zp2 A T 7: 120,143,576 probably benign Het
Other mutations in Taf1c
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00539:Taf1c APN 8 119601328 missense possibly damaging 0.80
IGL01098:Taf1c APN 8 119602841 missense probably damaging 0.98
IGL01287:Taf1c APN 8 119601192 missense probably benign 0.01
IGL02339:Taf1c APN 8 119604280 missense probably damaging 1.00
IGL02642:Taf1c APN 8 119599057 missense probably benign
IGL02954:Taf1c APN 8 119600486 missense probably damaging 1.00
R0026:Taf1c UTSW 8 119604236 splice site probably null
R0031:Taf1c UTSW 8 119599090 missense probably benign 0.00
R0087:Taf1c UTSW 8 119600987 missense probably damaging 1.00
R0701:Taf1c UTSW 8 119599983 missense probably damaging 0.98
R0883:Taf1c UTSW 8 119599983 missense probably damaging 0.98
R2200:Taf1c UTSW 8 119598678 missense probably benign
R3726:Taf1c UTSW 8 119603070 missense probably damaging 1.00
R3765:Taf1c UTSW 8 119600485 nonsense probably null
R3916:Taf1c UTSW 8 119600505 missense probably damaging 1.00
R4368:Taf1c UTSW 8 119599316 missense possibly damaging 0.60
R4470:Taf1c UTSW 8 119599622 missense probably benign
R4501:Taf1c UTSW 8 119599429 missense probably damaging 1.00
R4661:Taf1c UTSW 8 119598850 missense probably damaging 0.99
R4741:Taf1c UTSW 8 119603395 unclassified probably benign
R4938:Taf1c UTSW 8 119598798 missense probably benign 0.26
R5481:Taf1c UTSW 8 119599240 missense probably damaging 1.00
R6335:Taf1c UTSW 8 119601779 missense probably damaging 1.00
R6517:Taf1c UTSW 8 119604247 missense possibly damaging 0.59
Predicted Primers PCR Primer
(F):5'- TGGAAGTTCCCTCTCCTGGAGAAAG -3'
(R):5'- GGTGGAATGGGTCATCTGCAAACC -3'

Sequencing Primer
(F):5'- CCTCTCCTGGAGAAAGGACAG -3'
(R):5'- TGTCAGGGACTTCTGAGAACC -3'
Posted On2013-04-16