Incidental Mutation 'R2159:Stim2'
ID235035
Institutional Source Beutler Lab
Gene Symbol Stim2
Ensembl Gene ENSMUSG00000039156
Gene Namestromal interaction molecule 2
Synonyms
MMRRC Submission 040162-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2159 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location53998499-54121057 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 54109814 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 365 (Y365H)
Ref Sequence ENSEMBL: ENSMUSP00000113174 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000117661] [ENSMUST00000201469]
Predicted Effect possibly damaging
Transcript: ENSMUST00000071083
AA Change: Y365H

PolyPhen 2 Score 0.910 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000069272
Gene: ENSMUSG00000039156
AA Change: Y365H

DomainStartEndE-ValueType
low complexity region 23 47 N/A INTRINSIC
SAM 133 204 1.74e-3 SMART
PDB:4O9B|D 241 344 2e-36 PDB
Pfam:SOAR 345 453 1.7e-42 PFAM
low complexity region 513 526 N/A INTRINSIC
low complexity region 535 565 N/A INTRINSIC
low complexity region 610 621 N/A INTRINSIC
low complexity region 738 754 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000117661
AA Change: Y365H

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000113174
Gene: ENSMUSG00000039156
AA Change: Y365H

DomainStartEndE-ValueType
low complexity region 23 47 N/A INTRINSIC
SAM 133 204 1.74e-3 SMART
PDB:4O9B|D 241 344 2e-36 PDB
PDB:3TEQ|D 348 448 2e-38 PDB
low complexity region 505 518 N/A INTRINSIC
low complexity region 527 557 N/A INTRINSIC
low complexity region 602 613 N/A INTRINSIC
low complexity region 730 746 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000201198
AA Change: Y48H
Predicted Effect possibly damaging
Transcript: ENSMUST00000201469
AA Change: Y365H

PolyPhen 2 Score 0.956 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000143855
Gene: ENSMUSG00000039156
AA Change: Y365H

DomainStartEndE-ValueType
low complexity region 23 47 N/A INTRINSIC
SAM 133 204 1.74e-3 SMART
PDB:4O9B|D 241 344 2e-36 PDB
Pfam:SOAR 345 453 1.7e-42 PFAM
low complexity region 513 526 N/A INTRINSIC
low complexity region 535 565 N/A INTRINSIC
low complexity region 610 621 N/A INTRINSIC
low complexity region 738 754 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the stromal interaction molecule (STIM) family and likely arose, along with related family member STIM1, from a common ancestral gene. The encoded protein functions to regulate calcium concentrations in the cytosol and endoplasmic reticulum, and is involved in the activation of plasma membrane Orai Ca(2+) entry channels. This gene initiates translation from a non-AUG (UUG) start site. A signal peptide is cleaved from the resulting protein. Multiple transcript variants result from alternative splicing. [provided by RefSeq, Dec 2009]
PHENOTYPE: Mice homozygous for a null allele exhibit a slight growth delay and premature death while embryonic fibroblasts show reduced store-operated Ca2+ influx. Mice homozygous for a different null allele show increased neuron survival under hypoxic conditions and resistance to ischemic brain injury. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam21 G A 12: 81,560,467 P174S probably benign Het
Aida C T 1: 183,322,379 P185S probably benign Het
Alg11 T G 8: 22,065,845 I374R probably benign Het
Ano9 T C 7: 141,108,117 I229V probably benign Het
Apob A T 12: 8,010,081 L2821F probably benign Het
Atp10b C T 11: 43,151,853 T80I possibly damaging Het
BC024139 T C 15: 76,121,488 H478R probably damaging Het
Btbd1 A T 7: 81,801,056 D325E possibly damaging Het
Camk2a G A 18: 60,957,185 C199Y probably damaging Het
Casp3 A G 8: 46,634,288 D90G probably damaging Het
Ccnt2 A G 1: 127,775,154 H71R probably benign Het
Cdk2ap1 G A 5: 124,348,604 R65* probably null Het
Cebpb G T 2: 167,689,253 A78S probably benign Het
Col5a3 A G 9: 20,771,310 F1613L unknown Het
Cpd T C 11: 76,797,641 D935G probably damaging Het
Csmd3 CCTTTGCGCTT CCTT 15: 47,741,236 probably null Het
Cwc27 A G 13: 104,804,329 I174T probably damaging Het
Cyp21a1 C A 17: 34,802,404 R331L probably benign Het
Dnah5 A G 15: 28,252,545 T795A probably benign Het
Eif2ak2 A G 17: 78,874,018 V100A possibly damaging Het
Foxa3 A G 7: 19,014,184 V339A probably benign Het
Gp2 T C 7: 119,452,284 D236G probably benign Het
Gprc6a CAAA CA 10: 51,615,680 probably null Het
Gzmd T A 14: 56,130,696 H102L probably damaging Het
Klk1b1 A T 7: 43,970,433 I139F probably damaging Het
Lcmt2 G A 2: 121,139,285 P439L probably damaging Het
Loxl4 C T 19: 42,600,007 A570T probably damaging Het
Mga T A 2: 119,919,643 H674Q probably damaging Het
Mybpc3 A T 2: 91,125,370 K583M probably damaging Het
Ncoa6 G T 2: 155,407,713 P1224T probably damaging Het
Nostrin A G 2: 69,180,922 probably null Het
Olfr1264 A T 2: 90,021,538 V176E probably damaging Het
Olfr70 T C 4: 43,697,110 H21R probably benign Het
Oxsr1 A C 9: 119,304,814 D58E possibly damaging Het
Parm1 A G 5: 91,613,064 Y265C probably damaging Het
Phf10 C T 17: 14,952,664 E304K probably damaging Het
Prmt5 T C 14: 54,515,338 T139A probably benign Het
Ptgir A G 7: 16,906,869 M29V possibly damaging Het
Ptp4a3 A G 15: 73,752,016 T32A probably benign Het
Pwwp2b A T 7: 139,254,928 D95V possibly damaging Het
Rad51ap2 T C 12: 11,457,751 L558S possibly damaging Het
Rapgef4 A G 2: 72,174,881 D80G probably damaging Het
Sec24a T G 11: 51,712,350 H757P probably damaging Het
Sema4d T C 13: 51,720,535 N129D probably damaging Het
Serpini1 A G 3: 75,623,944 T323A probably benign Het
Setd1a G A 7: 127,785,489 R504H possibly damaging Het
Sftpb T C 6: 72,309,786 C226R probably damaging Het
Sp8 T C 12: 118,848,706 S99P possibly damaging Het
Srgap3 A G 6: 112,771,378 F438L probably damaging Het
Stk36 A G 1: 74,634,737 Q1263R probably benign Het
Tectb C G 19: 55,180,999 probably benign Het
Troap G T 15: 99,077,586 A184S probably damaging Het
Ttn G A 2: 76,899,327 probably benign Het
Vmn2r108 C A 17: 20,469,101 A531S probably benign Het
Vmn2r12 T A 5: 109,091,474 I408F probably benign Het
Vmn2r8 T A 5: 108,802,303 E226V probably benign Het
Vmo1 A G 11: 70,513,782 F131S probably benign Het
Vwf T C 6: 125,626,341 F885L probably damaging Het
Wdpcp A T 11: 21,857,476 M618L probably benign Het
Wdr90 T C 17: 25,851,741 E1072G probably benign Het
Other mutations in Stim2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00743:Stim2 APN 5 54053493 missense probably benign 0.09
IGL02276:Stim2 APN 5 54053370 splice site probably benign
IGL02643:Stim2 APN 5 54110613 missense probably damaging 1.00
R0368:Stim2 UTSW 5 54110140 critical splice donor site probably null
R0825:Stim2 UTSW 5 54118483 missense probably benign 0.22
R1453:Stim2 UTSW 5 54116109 missense probably damaging 1.00
R1549:Stim2 UTSW 5 54105325 missense probably damaging 1.00
R2103:Stim2 UTSW 5 54105249 missense possibly damaging 0.74
R2114:Stim2 UTSW 5 54104477 missense probably damaging 1.00
R2147:Stim2 UTSW 5 54105375 missense probably damaging 1.00
R4467:Stim2 UTSW 5 54116194 critical splice donor site probably null
R4809:Stim2 UTSW 5 54110613 missense probably damaging 1.00
R4857:Stim2 UTSW 5 54118546 missense probably damaging 1.00
R4959:Stim2 UTSW 5 54105370 missense probably benign
R5125:Stim2 UTSW 5 54110597 missense probably damaging 1.00
R5427:Stim2 UTSW 5 54110939 missense possibly damaging 0.95
R5441:Stim2 UTSW 5 54075370 nonsense probably null
R5617:Stim2 UTSW 5 54109733 missense probably damaging 0.99
R5924:Stim2 UTSW 5 54102643 missense probably benign 0.01
R6169:Stim2 UTSW 5 54118679 missense probably damaging 1.00
R6689:Stim2 UTSW 5 54115976 missense probably damaging 1.00
R6893:Stim2 UTSW 5 54053445 missense probably benign 0.13
R6971:Stim2 UTSW 5 54118299 nonsense probably null
R7133:Stim2 UTSW 5 53998921 missense possibly damaging 0.70
R7189:Stim2 UTSW 5 54116128 missense probably benign 0.08
Predicted Primers PCR Primer
(F):5'- GGCACCAATGTTTATTTCAGTCTC -3'
(R):5'- CTCAAGGACTCTACGGTAATTTTG -3'

Sequencing Primer
(F):5'- ATTTCAGTCTCTTCTTCCTTTTGTG -3'
(R):5'- GGACTCTACGGTAATTTTGAAAGC -3'
Posted On2014-10-01