Incidental Mutation 'R2159:Prmt5'
ID235072
Institutional Source Beutler Lab
Gene Symbol Prmt5
Ensembl Gene ENSMUSG00000023110
Gene Nameprotein arginine N-methyltransferase 5
SynonymsJak-binding protein 1, Jbp1, Skb1
MMRRC Submission 040162-MU
Accession Numbers

Genbank: NM_013768.3; Ensembl: ENSMUST00000023873

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R2159 (G1)
Quality Score225
Status Not validated
Chromosome14
Chromosomal Location54507187-54517525 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 54515338 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 139 (T139A)
Ref Sequence ENSEMBL: ENSMUSP00000023873 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023873] [ENSMUST00000132227] [ENSMUST00000147214]
Predicted Effect probably benign
Transcript: ENSMUST00000023873
AA Change: T139A

PolyPhen 2 Score 0.028 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000023873
Gene: ENSMUSG00000023110
AA Change: T139A

DomainStartEndE-ValueType
low complexity region 1 18 N/A INTRINSIC
Pfam:PRMT5 181 619 4.5e-184 PFAM
Pfam:SAMBD 184 465 3e-119 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000132227
SMART Domains Protein: ENSMUSP00000138549
Gene: ENSMUSG00000023110

DomainStartEndE-ValueType
low complexity region 1 18 N/A INTRINSIC
PDB:4GQB|A 19 40 5e-7 PDB
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132801
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133552
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138367
Predicted Effect probably benign
Transcript: ENSMUST00000139964
SMART Domains Protein: ENSMUSP00000121502
Gene: ENSMUSG00000023110

DomainStartEndE-ValueType
Pfam:PRMT5 1 62 1.3e-10 PFAM
Pfam:SAMBD 1 203 4.6e-68 PFAM
Pfam:PRMT5 52 203 1.2e-56 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000147214
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.3%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes an enzyme that belongs to the methyltransferase family. The encoded protein catalyzes the transfer of methyl groups to the amino acid arginine, in target proteins that include histones, transcriptional elongation factors and the tumor suppressor p53. This gene plays a role in several cellular processes, including transcriptional regulation and the assembly of small nuclear ribonucleoproteins. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Sep 2015]
PHENOTYPE: Mice homozygous for a null allele display embryonic lethality before somite formation with failure of inner cell mass proliferation. [provided by MGI curators]
Allele List at MGI

All alleles(9) : Targeted, other(4) Gene trapped(5)

Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam21 G A 12: 81,560,467 P174S probably benign Het
Aida C T 1: 183,322,379 P185S probably benign Het
Alg11 T G 8: 22,065,845 I374R probably benign Het
Ano9 T C 7: 141,108,117 I229V probably benign Het
Apob A T 12: 8,010,081 L2821F probably benign Het
Atp10b C T 11: 43,151,853 T80I possibly damaging Het
BC024139 T C 15: 76,121,488 H478R probably damaging Het
Btbd1 A T 7: 81,801,056 D325E possibly damaging Het
Camk2a G A 18: 60,957,185 C199Y probably damaging Het
Casp3 A G 8: 46,634,288 D90G probably damaging Het
Ccnt2 A G 1: 127,775,154 H71R probably benign Het
Cdk2ap1 G A 5: 124,348,604 R65* probably null Het
Cebpb G T 2: 167,689,253 A78S probably benign Het
Col5a3 A G 9: 20,771,310 F1613L unknown Het
Cpd T C 11: 76,797,641 D935G probably damaging Het
Csmd3 CCTTTGCGCTT CCTT 15: 47,741,236 probably null Het
Cwc27 A G 13: 104,804,329 I174T probably damaging Het
Cyp21a1 C A 17: 34,802,404 R331L probably benign Het
Dnah5 A G 15: 28,252,545 T795A probably benign Het
Eif2ak2 A G 17: 78,874,018 V100A possibly damaging Het
Foxa3 A G 7: 19,014,184 V339A probably benign Het
Gp2 T C 7: 119,452,284 D236G probably benign Het
Gprc6a CAAA CA 10: 51,615,680 probably null Het
Gzmd T A 14: 56,130,696 H102L probably damaging Het
Klk1b1 A T 7: 43,970,433 I139F probably damaging Het
Lcmt2 G A 2: 121,139,285 P439L probably damaging Het
Loxl4 C T 19: 42,600,007 A570T probably damaging Het
Mga T A 2: 119,919,643 H674Q probably damaging Het
Mybpc3 A T 2: 91,125,370 K583M probably damaging Het
Ncoa6 G T 2: 155,407,713 P1224T probably damaging Het
Nostrin A G 2: 69,180,922 probably null Het
Olfr1264 A T 2: 90,021,538 V176E probably damaging Het
Olfr70 T C 4: 43,697,110 H21R probably benign Het
Oxsr1 A C 9: 119,304,814 D58E possibly damaging Het
Parm1 A G 5: 91,613,064 Y265C probably damaging Het
Phf10 C T 17: 14,952,664 E304K probably damaging Het
Ptgir A G 7: 16,906,869 M29V possibly damaging Het
Ptp4a3 A G 15: 73,752,016 T32A probably benign Het
Pwwp2b A T 7: 139,254,928 D95V possibly damaging Het
Rad51ap2 T C 12: 11,457,751 L558S possibly damaging Het
Rapgef4 A G 2: 72,174,881 D80G probably damaging Het
Sec24a T G 11: 51,712,350 H757P probably damaging Het
Sema4d T C 13: 51,720,535 N129D probably damaging Het
Serpini1 A G 3: 75,623,944 T323A probably benign Het
Setd1a G A 7: 127,785,489 R504H possibly damaging Het
Sftpb T C 6: 72,309,786 C226R probably damaging Het
Sp8 T C 12: 118,848,706 S99P possibly damaging Het
Srgap3 A G 6: 112,771,378 F438L probably damaging Het
Stim2 T C 5: 54,109,814 Y365H probably damaging Het
Stk36 A G 1: 74,634,737 Q1263R probably benign Het
Tectb C G 19: 55,180,999 probably benign Het
Troap G T 15: 99,077,586 A184S probably damaging Het
Ttn G A 2: 76,899,327 probably benign Het
Vmn2r108 C A 17: 20,469,101 A531S probably benign Het
Vmn2r12 T A 5: 109,091,474 I408F probably benign Het
Vmn2r8 T A 5: 108,802,303 E226V probably benign Het
Vmo1 A G 11: 70,513,782 F131S probably benign Het
Vwf T C 6: 125,626,341 F885L probably damaging Het
Wdpcp A T 11: 21,857,476 M618L probably benign Het
Wdr90 T C 17: 25,851,741 E1072G probably benign Het
Other mutations in Prmt5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01309:Prmt5 APN 14 54509877 missense probably damaging 1.00
IGL01586:Prmt5 APN 14 54509951 unclassified probably benign
IGL02063:Prmt5 APN 14 54511020 nonsense probably null
IGL02249:Prmt5 APN 14 54509865 missense probably damaging 1.00
IGL03024:Prmt5 APN 14 54516598 missense possibly damaging 0.93
skipper UTSW 14 54509911 missense probably damaging 1.00
1mM(1):Prmt5 UTSW 14 54511500 critical splice donor site probably null
R0485:Prmt5 UTSW 14 54511255 missense probably damaging 1.00
R0664:Prmt5 UTSW 14 54507856 missense probably damaging 0.99
R1473:Prmt5 UTSW 14 54508915 missense probably damaging 1.00
R2106:Prmt5 UTSW 14 54507917 missense probably benign 0.00
R4728:Prmt5 UTSW 14 54507907 missense probably benign 0.00
R4843:Prmt5 UTSW 14 54516125 missense probably benign 0.33
R5261:Prmt5 UTSW 14 54507916 missense probably damaging 0.96
R5277:Prmt5 UTSW 14 54509942 missense probably benign 0.02
R5736:Prmt5 UTSW 14 54514840 missense probably null 0.84
R5892:Prmt5 UTSW 14 54509911 missense probably damaging 1.00
R5945:Prmt5 UTSW 14 54514887 missense possibly damaging 0.52
R7021:Prmt5 UTSW 14 54515388 missense probably damaging 1.00
R7091:Prmt5 UTSW 14 54511342 splice site probably null
R7172:Prmt5 UTSW 14 54514886 missense possibly damaging 0.92
Predicted Primers PCR Primer
(F):5'- TCTGCACACCACACTTAGGC -3'
(R):5'- TAGCTCAGTATGGCAGCTTATAG -3'

Sequencing Primer
(F):5'- ACCACACTTAGGCGGAGTCAG -3'
(R):5'- GCTACAGTGTCAGAGCCAGTTTC -3'
Posted On2014-10-01