Incidental Mutation 'R2160:Pla2g4e'
ID235091
Institutional Source Beutler Lab
Gene Symbol Pla2g4e
Ensembl Gene ENSMUSG00000050211
Gene Namephospholipase A2, group IVE
SynonymsPla2epsilon, 2310026J01Rik
MMRRC Submission 040163-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2160 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location120166412-120245335 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 120185206 bp
ZygosityHeterozygous
Amino Acid Change Serine to Glycine at position 286 (S286G)
Ref Sequence ENSEMBL: ENSMUSP00000087525 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000090071]
Predicted Effect probably benign
Transcript: ENSMUST00000090071
AA Change: S286G

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000087525
Gene: ENSMUSG00000050211
AA Change: S286G

DomainStartEndE-ValueType
low complexity region 61 73 N/A INTRINSIC
C2 82 182 3.42e-14 SMART
low complexity region 191 207 N/A INTRINSIC
PLAc 311 818 5.17e-13 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127009
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136845
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152263
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the cytosolic phospholipase A2 group IV family. Members of this family are involved in regulation of membrane tubule-mediated transport. The enzyme encoded by this member of the family plays a role in trafficking through the clathrin-independent endocytic pathway. The enzyme regulates the recycling process via formation of tubules that transport internalized clathrin-independent cargo proteins back to the cell surface. [provided by RefSeq, Jan 2017]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Bpifb9b A G 2: 154,319,675 N576D possibly damaging Het
Braf C T 6: 39,662,073 C248Y probably damaging Het
Carmil2 A G 8: 105,697,048 E1218G possibly damaging Het
Cntnap4 G T 8: 112,757,571 G419C probably damaging Het
Csmd3 CCTTTGCGCTT CCTT 15: 47,741,236 probably null Het
Dnah9 C T 11: 66,117,483 D839N probably damaging Het
Evc2 A G 5: 37,380,518 T517A possibly damaging Het
Fbxw8 G A 5: 118,124,988 P209S probably damaging Het
Gcm1 A G 9: 78,061,380 K121E probably benign Het
Gprc6a CAAA CA 10: 51,615,680 probably null Het
Herc2 A G 7: 56,212,922 D4077G probably benign Het
Inpp4b T A 8: 82,121,375 L937* probably null Het
Ipcef1 A T 10: 6,890,650 I349N probably damaging Het
Ipmk A G 10: 71,381,426 T267A probably benign Het
Jph3 G T 8: 121,753,231 R216L possibly damaging Het
Kctd16 A G 18: 40,259,085 E242G probably damaging Het
Klk14 G A 7: 43,692,077 C51Y probably damaging Het
Krt76 A G 15: 101,888,385 Y360H probably damaging Het
Lctl A G 9: 64,117,767 I12V probably benign Het
Lrig3 T C 10: 125,997,696 V347A possibly damaging Het
Lrrk2 C T 15: 91,796,060 S2058F probably damaging Het
Mark2 G C 19: 7,282,747 S111C probably damaging Het
Mon2 T A 10: 123,075,929 K12* probably null Het
Nupl1 A G 14: 60,239,508 V238A probably benign Het
Pak7 T C 2: 136,098,382 D504G probably benign Het
Ppfia4 A T 1: 134,313,723 V498D probably benign Het
Ppfibp1 A G 6: 147,027,453 E846G probably damaging Het
Ppp3ca G A 3: 136,877,630 C166Y probably damaging Het
Prpf3 T C 3: 95,845,230 K244E probably benign Het
Pzp A G 6: 128,525,276 S37P probably damaging Het
Rab11fip3 G A 17: 26,069,054 H42Y probably benign Het
Sprn C A 7: 140,153,506 probably benign Het
Tectb C G 19: 55,180,999 probably benign Het
Thap12 A G 7: 98,710,126 S71G probably damaging Het
Vmn1r7 A G 6: 57,024,894 F127S probably damaging Het
Vmn2r54 C T 7: 12,615,493 V721I probably benign Het
Vmn2r56 A G 7: 12,694,219 F707L probably benign Het
Zfp976 C T 7: 42,613,930 S161N probably benign Het
Other mutations in Pla2g4e
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00470:Pla2g4e APN 2 120185238 missense probably benign
IGL01712:Pla2g4e APN 2 120189403 critical splice donor site probably null
IGL01859:Pla2g4e APN 2 120182733 missense possibly damaging 0.70
IGL02334:Pla2g4e APN 2 120187236 missense probably benign
FR4737:Pla2g4e UTSW 2 120244724 small deletion probably benign
R0157:Pla2g4e UTSW 2 120170181 missense probably benign 0.00
R0578:Pla2g4e UTSW 2 120244681 splice site probably benign
R0675:Pla2g4e UTSW 2 120200198 splice site probably benign
R1278:Pla2g4e UTSW 2 120168470 critical splice donor site probably null
R1346:Pla2g4e UTSW 2 120182772 missense probably damaging 1.00
R1760:Pla2g4e UTSW 2 120170046 missense possibly damaging 0.50
R1773:Pla2g4e UTSW 2 120244721 missense probably benign
R1792:Pla2g4e UTSW 2 120168474 missense probably damaging 1.00
R2129:Pla2g4e UTSW 2 120182811 missense probably damaging 0.99
R2191:Pla2g4e UTSW 2 120191199 frame shift probably null
R3901:Pla2g4e UTSW 2 120168604 missense probably benign 0.00
R4342:Pla2g4e UTSW 2 120186446 intron probably benign
R4414:Pla2g4e UTSW 2 120182713 missense probably benign
R4460:Pla2g4e UTSW 2 120186382 missense possibly damaging 0.53
R4581:Pla2g4e UTSW 2 120186382 missense possibly damaging 0.53
R4599:Pla2g4e UTSW 2 120186382 missense possibly damaging 0.53
R4601:Pla2g4e UTSW 2 120186382 missense possibly damaging 0.53
R4610:Pla2g4e UTSW 2 120186382 missense possibly damaging 0.53
R4611:Pla2g4e UTSW 2 120186382 missense possibly damaging 0.53
R4664:Pla2g4e UTSW 2 120171188 missense probably damaging 0.97
R4688:Pla2g4e UTSW 2 120167933 missense possibly damaging 0.82
R4691:Pla2g4e UTSW 2 120174300 missense probably damaging 1.00
R4944:Pla2g4e UTSW 2 120171237 missense probably benign 0.01
R5051:Pla2g4e UTSW 2 120174304 missense probably damaging 1.00
R5285:Pla2g4e UTSW 2 120189504 missense probably damaging 1.00
R5373:Pla2g4e UTSW 2 120186395 missense probably benign 0.30
R5374:Pla2g4e UTSW 2 120186395 missense probably benign 0.30
R5505:Pla2g4e UTSW 2 120244775 missense probably benign 0.08
R5702:Pla2g4e UTSW 2 120188511 missense possibly damaging 0.61
R6300:Pla2g4e UTSW 2 120182738 missense probably benign 0.00
R6711:Pla2g4e UTSW 2 120171270 missense probably benign 0.00
R6920:Pla2g4e UTSW 2 120185314 missense possibly damaging 0.82
R6961:Pla2g4e UTSW 2 120174370 splice site probably null
R6987:Pla2g4e UTSW 2 120186380 missense probably benign 0.01
R7028:Pla2g4e UTSW 2 120170195 missense probably damaging 1.00
R7138:Pla2g4e UTSW 2 120171278 missense probably damaging 1.00
R7300:Pla2g4e UTSW 2 120191199 missense probably damaging 1.00
R7355:Pla2g4e UTSW 2 120181501 missense possibly damaging 0.91
Predicted Primers PCR Primer
(F):5'- GGCCATCAGAAAGGCAATTG -3'
(R):5'- TTTGCTGGGCTAAACGGGAAG -3'

Sequencing Primer
(F):5'- TTGAGGGGCTGGCAGAC -3'
(R):5'- GAAACTTCCCAGGGGTCTAAC -3'
Posted On2014-10-01