Incidental Mutation 'R2160:Bpifb9b'
ID235093
Institutional Source Beutler Lab
Gene Symbol Bpifb9b
Ensembl Gene ENSMUSG00000067996
Gene NameBPI fold containing family B, member 9B
SynonymsOTTMUSG00000015915, 5430413K10Rik
MMRRC Submission 040163-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.091) question?
Stock #R2160 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location154307227-154320646 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 154319675 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Aspartic acid at position 576 (N576D)
Ref Sequence ENSEMBL: ENSMUSP00000086311 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000088921]
Predicted Effect possibly damaging
Transcript: ENSMUST00000088921
AA Change: N576D

PolyPhen 2 Score 0.528 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000086311
Gene: ENSMUSG00000067996
AA Change: N576D

DomainStartEndE-ValueType
low complexity region 29 42 N/A INTRINSIC
low complexity region 60 77 N/A INTRINSIC
low complexity region 122 157 N/A INTRINSIC
low complexity region 167 181 N/A INTRINSIC
low complexity region 184 203 N/A INTRINSIC
Pfam:LBP_BPI_CETP 216 377 1.7e-11 PFAM
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Braf C T 6: 39,662,073 C248Y probably damaging Het
Carmil2 A G 8: 105,697,048 E1218G possibly damaging Het
Cntnap4 G T 8: 112,757,571 G419C probably damaging Het
Csmd3 CCTTTGCGCTT CCTT 15: 47,741,236 probably null Het
Dnah9 C T 11: 66,117,483 D839N probably damaging Het
Evc2 A G 5: 37,380,518 T517A possibly damaging Het
Fbxw8 G A 5: 118,124,988 P209S probably damaging Het
Gcm1 A G 9: 78,061,380 K121E probably benign Het
Gprc6a CAAA CA 10: 51,615,680 probably null Het
Herc2 A G 7: 56,212,922 D4077G probably benign Het
Inpp4b T A 8: 82,121,375 L937* probably null Het
Ipcef1 A T 10: 6,890,650 I349N probably damaging Het
Ipmk A G 10: 71,381,426 T267A probably benign Het
Jph3 G T 8: 121,753,231 R216L possibly damaging Het
Kctd16 A G 18: 40,259,085 E242G probably damaging Het
Klk14 G A 7: 43,692,077 C51Y probably damaging Het
Krt76 A G 15: 101,888,385 Y360H probably damaging Het
Lctl A G 9: 64,117,767 I12V probably benign Het
Lrig3 T C 10: 125,997,696 V347A possibly damaging Het
Lrrk2 C T 15: 91,796,060 S2058F probably damaging Het
Mark2 G C 19: 7,282,747 S111C probably damaging Het
Mon2 T A 10: 123,075,929 K12* probably null Het
Nupl1 A G 14: 60,239,508 V238A probably benign Het
Pak7 T C 2: 136,098,382 D504G probably benign Het
Pla2g4e T C 2: 120,185,206 S286G probably benign Het
Ppfia4 A T 1: 134,313,723 V498D probably benign Het
Ppfibp1 A G 6: 147,027,453 E846G probably damaging Het
Ppp3ca G A 3: 136,877,630 C166Y probably damaging Het
Prpf3 T C 3: 95,845,230 K244E probably benign Het
Pzp A G 6: 128,525,276 S37P probably damaging Het
Rab11fip3 G A 17: 26,069,054 H42Y probably benign Het
Sprn C A 7: 140,153,506 probably benign Het
Tectb C G 19: 55,180,999 probably benign Het
Thap12 A G 7: 98,710,126 S71G probably damaging Het
Vmn1r7 A G 6: 57,024,894 F127S probably damaging Het
Vmn2r54 C T 7: 12,615,493 V721I probably benign Het
Vmn2r56 A G 7: 12,694,219 F707L probably benign Het
Zfp976 C T 7: 42,613,930 S161N probably benign Het
Other mutations in Bpifb9b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01621:Bpifb9b APN 2 154316951 splice site probably null
IGL02119:Bpifb9b APN 2 154313624 missense possibly damaging 0.84
IGL02658:Bpifb9b APN 2 154311281 missense probably benign 0.00
R0230:Bpifb9b UTSW 2 154317075 missense probably damaging 1.00
R0269:Bpifb9b UTSW 2 154319625 missense probably benign 0.00
R0617:Bpifb9b UTSW 2 154319625 missense probably benign 0.00
R1953:Bpifb9b UTSW 2 154311314 missense probably damaging 0.99
R2050:Bpifb9b UTSW 2 154309604 missense possibly damaging 0.93
R2200:Bpifb9b UTSW 2 154313654 missense probably benign 0.00
R2354:Bpifb9b UTSW 2 154311742 missense probably benign
R4755:Bpifb9b UTSW 2 154319694 missense probably benign 0.01
R4872:Bpifb9b UTSW 2 154313631 missense probably damaging 0.99
R4914:Bpifb9b UTSW 2 154314106 splice site probably null
R4915:Bpifb9b UTSW 2 154314106 splice site probably null
R4917:Bpifb9b UTSW 2 154314106 splice site probably null
R4918:Bpifb9b UTSW 2 154314106 splice site probably null
R4950:Bpifb9b UTSW 2 154311659 missense probably damaging 1.00
R5438:Bpifb9b UTSW 2 154309368 missense possibly damaging 0.65
R5507:Bpifb9b UTSW 2 154317027 missense possibly damaging 0.91
R6255:Bpifb9b UTSW 2 154309364 missense probably damaging 0.98
R7130:Bpifb9b UTSW 2 154311672 missense probably damaging 0.98
R7161:Bpifb9b UTSW 2 154313615 missense possibly damaging 0.95
Predicted Primers PCR Primer
(F):5'- AGTGTGACAGTGACTCCTCC -3'
(R):5'- AGGCACTGTAGGAATTGACTTAGG -3'

Sequencing Primer
(F):5'- TGTGACAGTGACTCCTCCTAGGG -3'
(R):5'- CACTGTAGGAATTGACTTAGGCTCAG -3'
Posted On2014-10-01