Incidental Mutation 'R2160:Sprn'
ID235112
Institutional Source Beutler Lab
Gene Symbol Sprn
Ensembl Gene ENSMUSG00000045733
Gene Nameshadow of prion protein
Synonymsshadoo
MMRRC Submission 040163-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2160 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location140150628-140154877 bp(-) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) C to A at 140153506 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000036491 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000036977] [ENSMUST00000059241]
Predicted Effect probably benign
Transcript: ENSMUST00000036977
SMART Domains Protein: ENSMUSP00000036491
Gene: ENSMUSG00000039018

DomainStartEndE-ValueType
SCOP:d1egaa1 31 129 5e-6 SMART
Pfam:FeoB_N 143 219 3.9e-6 PFAM
Pfam:MMR_HSR1 144 283 2.4e-13 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000059241
AA Change: R51M
SMART Domains Protein: ENSMUSP00000053901
Gene: ENSMUSG00000045733
AA Change: R51M

DomainStartEndE-ValueType
Pfam:Shadoo 19 147 7.2e-71 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155723
Predicted Effect unknown
Transcript: ENSMUST00000156791
AA Change: R12M
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit normal survival but abnormal body weight. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Bpifb9b A G 2: 154,319,675 N576D possibly damaging Het
Braf C T 6: 39,662,073 C248Y probably damaging Het
Carmil2 A G 8: 105,697,048 E1218G possibly damaging Het
Cntnap4 G T 8: 112,757,571 G419C probably damaging Het
Csmd3 CCTTTGCGCTT CCTT 15: 47,741,236 probably null Het
Dnah9 C T 11: 66,117,483 D839N probably damaging Het
Evc2 A G 5: 37,380,518 T517A possibly damaging Het
Fbxw8 G A 5: 118,124,988 P209S probably damaging Het
Gcm1 A G 9: 78,061,380 K121E probably benign Het
Gprc6a CAAA CA 10: 51,615,680 probably null Het
Herc2 A G 7: 56,212,922 D4077G probably benign Het
Inpp4b T A 8: 82,121,375 L937* probably null Het
Ipcef1 A T 10: 6,890,650 I349N probably damaging Het
Ipmk A G 10: 71,381,426 T267A probably benign Het
Jph3 G T 8: 121,753,231 R216L possibly damaging Het
Kctd16 A G 18: 40,259,085 E242G probably damaging Het
Klk14 G A 7: 43,692,077 C51Y probably damaging Het
Krt76 A G 15: 101,888,385 Y360H probably damaging Het
Lctl A G 9: 64,117,767 I12V probably benign Het
Lrig3 T C 10: 125,997,696 V347A possibly damaging Het
Lrrk2 C T 15: 91,796,060 S2058F probably damaging Het
Mark2 G C 19: 7,282,747 S111C probably damaging Het
Mon2 T A 10: 123,075,929 K12* probably null Het
Nupl1 A G 14: 60,239,508 V238A probably benign Het
Pak7 T C 2: 136,098,382 D504G probably benign Het
Pla2g4e T C 2: 120,185,206 S286G probably benign Het
Ppfia4 A T 1: 134,313,723 V498D probably benign Het
Ppfibp1 A G 6: 147,027,453 E846G probably damaging Het
Ppp3ca G A 3: 136,877,630 C166Y probably damaging Het
Prpf3 T C 3: 95,845,230 K244E probably benign Het
Pzp A G 6: 128,525,276 S37P probably damaging Het
Rab11fip3 G A 17: 26,069,054 H42Y probably benign Het
Tectb C G 19: 55,180,999 probably benign Het
Thap12 A G 7: 98,710,126 S71G probably damaging Het
Vmn1r7 A G 6: 57,024,894 F127S probably damaging Het
Vmn2r54 C T 7: 12,615,493 V721I probably benign Het
Vmn2r56 A G 7: 12,694,219 F707L probably benign Het
Zfp976 C T 7: 42,613,930 S161N probably benign Het
Other mutations in Sprn
AlleleSourceChrCoordTypePredicted EffectPPH Score
R1752:Sprn UTSW 7 140153495 unclassified probably benign
R1922:Sprn UTSW 7 140153545 unclassified probably benign
R4696:Sprn UTSW 7 140153556 unclassified probably benign
Predicted Primers PCR Primer
(F):5'- AAATACGTGGGCTGTGCACG -3'
(R):5'- ACAGAAGCTGAAGCCCCTTC -3'

Sequencing Primer
(F):5'- AGTAGCTGTAGACTCCTCGGTC -3'
(R):5'- GCTGAAGCCCCTTCCACCC -3'
Posted On2014-10-01