Incidental Mutation 'R2160:Carmil2'
ID235114
Institutional Source Beutler Lab
Gene Symbol Carmil2
Ensembl Gene ENSMUSG00000050357
Gene Namecapping protein regulator and myosin 1 linker 2
SynonymsD130029J02Rik, Rltpr
MMRRC Submission 040163-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.150) question?
Stock #R2160 (G1)
Quality Score225
Status Not validated
Chromosome8
Chromosomal Location105686274-105698187 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 105697048 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 1218 (E1218G)
Ref Sequence ENSEMBL: ENSMUSP00000148422 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042608] [ENSMUST00000062574] [ENSMUST00000093195] [ENSMUST00000098444] [ENSMUST00000211870] [ENSMUST00000211888] [ENSMUST00000212352] [ENSMUST00000212430] [ENSMUST00000212642] [ENSMUST00000212650] [ENSMUST00000213019]
Predicted Effect probably benign
Transcript: ENSMUST00000042608
SMART Domains Protein: ENSMUSP00000048180
Gene: ENSMUSG00000038000

DomainStartEndE-ValueType
Pfam:TPP1 11 118 2.4e-23 PFAM
low complexity region 259 272 N/A INTRINSIC
low complexity region 296 319 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000062574
SMART Domains Protein: ENSMUSP00000052322
Gene: ENSMUSG00000050357

DomainStartEndE-ValueType
Pfam:CARMIL_C 149 442 3.3e-62 PFAM
low complexity region 467 484 N/A INTRINSIC
low complexity region 631 659 N/A INTRINSIC
low complexity region 696 727 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000093195
SMART Domains Protein: ENSMUSP00000090886
Gene: ENSMUSG00000005699

DomainStartEndE-ValueType
PB1 15 95 2.81e-15 SMART
PDZ 167 250 1.38e-12 SMART
low complexity region 263 286 N/A INTRINSIC
low complexity region 309 323 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000098444
SMART Domains Protein: ENSMUSP00000096043
Gene: ENSMUSG00000005699

DomainStartEndE-ValueType
PB1 4 79 1.28e-9 SMART
PDZ 151 234 1.38e-12 SMART
low complexity region 247 270 N/A INTRINSIC
low complexity region 293 307 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000211870
Predicted Effect probably benign
Transcript: ENSMUST00000211888
Predicted Effect probably benign
Transcript: ENSMUST00000212352
Predicted Effect probably benign
Transcript: ENSMUST00000212430
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212634
Predicted Effect probably benign
Transcript: ENSMUST00000212642
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212643
Predicted Effect probably benign
Transcript: ENSMUST00000212650
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212687
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212972
Predicted Effect possibly damaging
Transcript: ENSMUST00000213019
AA Change: E1218G

PolyPhen 2 Score 0.945 (Sensitivity: 0.80; Specificity: 0.95)
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out or ENU-induced allele exhibit decreased regulatory T cells and reduced proliferative and IL2-secretion response to anti-CD3 and anti-CD28 antibodies. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Bpifb9b A G 2: 154,319,675 N576D possibly damaging Het
Braf C T 6: 39,662,073 C248Y probably damaging Het
Cntnap4 G T 8: 112,757,571 G419C probably damaging Het
Csmd3 CCTTTGCGCTT CCTT 15: 47,741,236 probably null Het
Dnah9 C T 11: 66,117,483 D839N probably damaging Het
Evc2 A G 5: 37,380,518 T517A possibly damaging Het
Fbxw8 G A 5: 118,124,988 P209S probably damaging Het
Gcm1 A G 9: 78,061,380 K121E probably benign Het
Gprc6a CAAA CA 10: 51,615,680 probably null Het
Herc2 A G 7: 56,212,922 D4077G probably benign Het
Inpp4b T A 8: 82,121,375 L937* probably null Het
Ipcef1 A T 10: 6,890,650 I349N probably damaging Het
Ipmk A G 10: 71,381,426 T267A probably benign Het
Jph3 G T 8: 121,753,231 R216L possibly damaging Het
Kctd16 A G 18: 40,259,085 E242G probably damaging Het
Klk14 G A 7: 43,692,077 C51Y probably damaging Het
Krt76 A G 15: 101,888,385 Y360H probably damaging Het
Lctl A G 9: 64,117,767 I12V probably benign Het
Lrig3 T C 10: 125,997,696 V347A possibly damaging Het
Lrrk2 C T 15: 91,796,060 S2058F probably damaging Het
Mark2 G C 19: 7,282,747 S111C probably damaging Het
Mon2 T A 10: 123,075,929 K12* probably null Het
Nupl1 A G 14: 60,239,508 V238A probably benign Het
Pak7 T C 2: 136,098,382 D504G probably benign Het
Pla2g4e T C 2: 120,185,206 S286G probably benign Het
Ppfia4 A T 1: 134,313,723 V498D probably benign Het
Ppfibp1 A G 6: 147,027,453 E846G probably damaging Het
Ppp3ca G A 3: 136,877,630 C166Y probably damaging Het
Prpf3 T C 3: 95,845,230 K244E probably benign Het
Pzp A G 6: 128,525,276 S37P probably damaging Het
Rab11fip3 G A 17: 26,069,054 H42Y probably benign Het
Sprn C A 7: 140,153,506 probably benign Het
Tectb C G 19: 55,180,999 probably benign Het
Thap12 A G 7: 98,710,126 S71G probably damaging Het
Vmn1r7 A G 6: 57,024,894 F127S probably damaging Het
Vmn2r54 C T 7: 12,615,493 V721I probably benign Het
Vmn2r56 A G 7: 12,694,219 F707L probably benign Het
Zfp976 C T 7: 42,613,930 S161N probably benign Het
Other mutations in Carmil2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00087:Carmil2 APN 8 105691406 missense probably benign 0.39
IGL01295:Carmil2 APN 8 105695516 missense probably benign 0.44
IGL02055:Carmil2 APN 8 105696907 splice site probably benign
IGL02532:Carmil2 APN 8 105692431 critical splice donor site probably null
IGL02900:Carmil2 APN 8 105695519 missense probably damaging 1.00
IGL03242:Carmil2 APN 8 105691320 splice site probably benign
IGL03335:Carmil2 APN 8 105697029 missense probably benign 0.14
R0544:Carmil2 UTSW 8 105691235 missense probably damaging 1.00
R2512:Carmil2 UTSW 8 105697393 missense probably benign 0.31
R2877:Carmil2 UTSW 8 105695423 missense probably damaging 1.00
R2943:Carmil2 UTSW 8 105692932 missense probably benign 0.17
R4038:Carmil2 UTSW 8 105695407 missense probably damaging 0.99
R4615:Carmil2 UTSW 8 105695074 missense possibly damaging 0.94
R4914:Carmil2 UTSW 8 105693543 missense possibly damaging 0.85
R5106:Carmil2 UTSW 8 105694006 splice site probably null
R5125:Carmil2 UTSW 8 105696889 missense probably damaging 1.00
R5178:Carmil2 UTSW 8 105696889 missense probably damaging 1.00
R5735:Carmil2 UTSW 8 105698031 missense probably damaging 1.00
R5991:Carmil2 UTSW 8 105691391 missense probably null 1.00
R6035:Carmil2 UTSW 8 105692563 missense probably benign 0.27
R6035:Carmil2 UTSW 8 105692563 missense probably benign 0.27
R6226:Carmil2 UTSW 8 105689032 missense possibly damaging 0.88
R6411:Carmil2 UTSW 8 105697026 missense probably damaging 1.00
R7263:Carmil2 UTSW 8 105693045 missense probably damaging 1.00
R7368:Carmil2 UTSW 8 105690835 missense possibly damaging 0.46
Predicted Primers PCR Primer
(F):5'- ATCAAGAAGGCAGGCTCTG -3'
(R):5'- AATGTCTTCCAGGTGGCAGAC -3'

Sequencing Primer
(F):5'- TCTGATGGTGAGTAGGACCCC -3'
(R):5'- CAGGTCTGCATGAGGGATC -3'
Posted On2014-10-01