Incidental Mutation 'R2160:Lctl'
ID235117
Institutional Source Beutler Lab
Gene Symbol Lctl
Ensembl Gene ENSMUSG00000032401
Gene Namelactase-like
SynonymsE130104I05Rik, KLPH
MMRRC Submission 040163-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.107) question?
Stock #R2160 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location64117147-64138118 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 64117767 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 12 (I12V)
Ref Sequence ENSEMBL: ENSMUSP00000120815 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034969] [ENSMUST00000118215] [ENSMUST00000124020]
Predicted Effect probably benign
Transcript: ENSMUST00000034969
AA Change: I12V

PolyPhen 2 Score 0.023 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000034969
Gene: ENSMUSG00000032401
AA Change: I12V

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Pfam:Glyco_hydro_1 32 502 1.7e-161 PFAM
transmembrane domain 540 562 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000118215
SMART Domains Protein: ENSMUSP00000112979
Gene: ENSMUSG00000032401

DomainStartEndE-ValueType
Pfam:Glyco_hydro_1 1 343 5.8e-99 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000124020
AA Change: I12V

PolyPhen 2 Score 0.023 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000120815
Gene: ENSMUSG00000032401
AA Change: I12V

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Pfam:Glyco_hydro_1 32 235 2.3e-84 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132018
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139755
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145011
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of family 1 glycosidases. Glycosidases are enzymes that hydrolyze glycosidic bonds and are classified into families based on primary amino acid sequence. Most members of family 1 have two conserved glutamic acid residues, which are required for enzymatic activity. The mouse ortholog of this protein has been characterized and has a domain structure of an N-terminal signal peptide, glycosidase domain, transmembrane domain, and a short cytoplasmic tail. It lacks one of the conserved glutamic acid residues important for catalysis, and its function remains to be determined (PMID: 12084582). Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jun 2013]
PHENOTYPE: No notable phenotype was detected in a high-throughput screen of homozygous null mice. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Bpifb9b A G 2: 154,319,675 N576D possibly damaging Het
Braf C T 6: 39,662,073 C248Y probably damaging Het
Carmil2 A G 8: 105,697,048 E1218G possibly damaging Het
Cntnap4 G T 8: 112,757,571 G419C probably damaging Het
Csmd3 CCTTTGCGCTT CCTT 15: 47,741,236 probably null Het
Dnah9 C T 11: 66,117,483 D839N probably damaging Het
Evc2 A G 5: 37,380,518 T517A possibly damaging Het
Fbxw8 G A 5: 118,124,988 P209S probably damaging Het
Gcm1 A G 9: 78,061,380 K121E probably benign Het
Gprc6a CAAA CA 10: 51,615,680 probably null Het
Herc2 A G 7: 56,212,922 D4077G probably benign Het
Inpp4b T A 8: 82,121,375 L937* probably null Het
Ipcef1 A T 10: 6,890,650 I349N probably damaging Het
Ipmk A G 10: 71,381,426 T267A probably benign Het
Jph3 G T 8: 121,753,231 R216L possibly damaging Het
Kctd16 A G 18: 40,259,085 E242G probably damaging Het
Klk14 G A 7: 43,692,077 C51Y probably damaging Het
Krt76 A G 15: 101,888,385 Y360H probably damaging Het
Lrig3 T C 10: 125,997,696 V347A possibly damaging Het
Lrrk2 C T 15: 91,796,060 S2058F probably damaging Het
Mark2 G C 19: 7,282,747 S111C probably damaging Het
Mon2 T A 10: 123,075,929 K12* probably null Het
Nupl1 A G 14: 60,239,508 V238A probably benign Het
Pak7 T C 2: 136,098,382 D504G probably benign Het
Pla2g4e T C 2: 120,185,206 S286G probably benign Het
Ppfia4 A T 1: 134,313,723 V498D probably benign Het
Ppfibp1 A G 6: 147,027,453 E846G probably damaging Het
Ppp3ca G A 3: 136,877,630 C166Y probably damaging Het
Prpf3 T C 3: 95,845,230 K244E probably benign Het
Pzp A G 6: 128,525,276 S37P probably damaging Het
Rab11fip3 G A 17: 26,069,054 H42Y probably benign Het
Sprn C A 7: 140,153,506 probably benign Het
Tectb C G 19: 55,180,999 probably benign Het
Thap12 A G 7: 98,710,126 S71G probably damaging Het
Vmn1r7 A G 6: 57,024,894 F127S probably damaging Het
Vmn2r54 C T 7: 12,615,493 V721I probably benign Het
Vmn2r56 A G 7: 12,694,219 F707L probably benign Het
Zfp976 C T 7: 42,613,930 S161N probably benign Het
Other mutations in Lctl
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00944:Lctl APN 9 64133129 nonsense probably null
IGL03066:Lctl APN 9 64117735 start codon destroyed probably null 0.66
IGL03302:Lctl APN 9 64134848 unclassified probably benign
R0077:Lctl UTSW 9 64122107 start codon destroyed probably null 0.64
R0137:Lctl UTSW 9 64117698 utr 5 prime probably benign
R0335:Lctl UTSW 9 64118887 missense probably benign 0.00
R0391:Lctl UTSW 9 64122314 splice site probably benign
R1740:Lctl UTSW 9 64133107 missense probably damaging 1.00
R1866:Lctl UTSW 9 64131721 missense probably damaging 1.00
R2867:Lctl UTSW 9 64137868 missense probably benign 0.23
R2867:Lctl UTSW 9 64137868 missense probably benign 0.23
R3605:Lctl UTSW 9 64133193 missense probably damaging 1.00
R3607:Lctl UTSW 9 64133193 missense probably damaging 1.00
R4585:Lctl UTSW 9 64131600 missense probably damaging 1.00
R4861:Lctl UTSW 9 64119763 missense possibly damaging 0.55
R4861:Lctl UTSW 9 64119763 missense possibly damaging 0.55
R5249:Lctl UTSW 9 64137914 missense probably benign
R7021:Lctl UTSW 9 64132793 splice site probably null
R7106:Lctl UTSW 9 64132837 missense probably benign 0.22
R7221:Lctl UTSW 9 64118935 nonsense probably null
R7265:Lctl UTSW 9 64126921 missense probably damaging 1.00
R7353:Lctl UTSW 9 64126967 missense probably damaging 1.00
R7501:Lctl UTSW 9 64131579 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TGGCTCAGCTTCTGCACATTG -3'
(R):5'- ATCCTATGAGACAGGAAGCCAG -3'

Sequencing Primer
(F):5'- GTTTAATGCAGGGTCCCACAC -3'
(R):5'- CAATTCCTTGGCAAGTCAGC -3'
Posted On2014-10-01