Incidental Mutation 'R2160:Ipcef1'
ID235119
Institutional Source Beutler Lab
Gene Symbol Ipcef1
Ensembl Gene ENSMUSG00000064065
Gene Nameinteraction protein for cytohesin exchange factors 1
Synonyms
MMRRC Submission 040163-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.081) question?
Stock #R2160 (G1)
Quality Score225
Status Not validated
Chromosome10
Chromosomal Location6885796-7052478 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 6890650 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 349 (I349N)
Ref Sequence ENSEMBL: ENSMUSP00000101242 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000052751] [ENSMUST00000063036] [ENSMUST00000078070] [ENSMUST00000105601] [ENSMUST00000105611] [ENSMUST00000105615] [ENSMUST00000105617] [ENSMUST00000123861] [ENSMUST00000129221] [ENSMUST00000129954] [ENSMUST00000135502] [ENSMUST00000144264] [ENSMUST00000147171] [ENSMUST00000154941]
Predicted Effect probably benign
Transcript: ENSMUST00000052751
SMART Domains Protein: ENSMUSP00000060329
Gene: ENSMUSG00000000766

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srx 76 325 1.1e-7 PFAM
Pfam:7TM_GPCR_Srsx 79 351 1e-10 PFAM
Pfam:7tm_1 85 336 3.2e-67 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000063036
SMART Domains Protein: ENSMUSP00000053498
Gene: ENSMUSG00000000766

DomainStartEndE-ValueType
Pfam:7tm_1 24 268 8.7e-64 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000078070
AA Change: I353N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000077215
Gene: ENSMUSG00000064065
AA Change: I353N

DomainStartEndE-ValueType
PH 14 114 5.87e-20 SMART
low complexity region 132 150 N/A INTRINSIC
low complexity region 246 261 N/A INTRINSIC
Blast:PH 286 343 1e-10 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000105601
SMART Domains Protein: ENSMUSP00000101226
Gene: ENSMUSG00000000766

DomainStartEndE-ValueType
SCOP:d1l9ha_ 46 100 3e-9 SMART
PDB:4DKL|A 52 100 3e-21 PDB
low complexity region 119 131 N/A INTRINSIC
low complexity region 173 184 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000105611
SMART Domains Protein: ENSMUSP00000101236
Gene: ENSMUSG00000000766

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srx 76 338 1.7e-7 PFAM
Pfam:7TM_GPCR_Srsx 79 351 1.4e-10 PFAM
Pfam:7tm_1 85 336 4.4e-67 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000105615
SMART Domains Protein: ENSMUSP00000101240
Gene: ENSMUSG00000000766

DomainStartEndE-ValueType
Pfam:7tm_1 24 268 1.3e-63 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000105617
AA Change: I349N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000101242
Gene: ENSMUSG00000064065
AA Change: I349N

DomainStartEndE-ValueType
PH 14 114 5.87e-20 SMART
low complexity region 132 153 N/A INTRINSIC
low complexity region 242 257 N/A INTRINSIC
Blast:PH 282 339 1e-10 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000123861
SMART Domains Protein: ENSMUSP00000120187
Gene: ENSMUSG00000000766

DomainStartEndE-ValueType
SCOP:d1l9ha_ 46 100 3e-9 SMART
PDB:4DKL|A 52 100 3e-21 PDB
low complexity region 119 131 N/A INTRINSIC
low complexity region 173 184 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000129221
SMART Domains Protein: ENSMUSP00000123117
Gene: ENSMUSG00000000766

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srx 12 261 1.1e-7 PFAM
Pfam:7TM_GPCR_Srsx 15 287 7.3e-11 PFAM
Pfam:7tm_1 21 272 2.4e-67 PFAM
low complexity region 340 351 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000129954
SMART Domains Protein: ENSMUSP00000122385
Gene: ENSMUSG00000000766

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srx 76 338 6.9e-8 PFAM
Pfam:7TM_GPCR_Srsx 79 351 1.5e-10 PFAM
Pfam:7tm_1 85 336 5.4e-67 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000135502
SMART Domains Protein: ENSMUSP00000135143
Gene: ENSMUSG00000000766

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srx 76 339 2.2e-7 PFAM
Pfam:7TM_GPCR_Srsx 79 351 1.9e-10 PFAM
Pfam:7tm_1 85 336 7.5e-67 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141897
Predicted Effect probably benign
Transcript: ENSMUST00000144264
SMART Domains Protein: ENSMUSP00000115836
Gene: ENSMUSG00000000766

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srx 76 325 1.7e-7 PFAM
Pfam:7TM_GPCR_Srsx 79 351 1e-10 PFAM
Pfam:7tm_1 85 336 3.4e-67 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000147171
SMART Domains Protein: ENSMUSP00000117950
Gene: ENSMUSG00000000766

DomainStartEndE-ValueType
Pfam:7tm_1 24 268 9.2e-64 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000154941
SMART Domains Protein: ENSMUSP00000115413
Gene: ENSMUSG00000000766

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srx 12 261 9.6e-8 PFAM
Pfam:7TM_GPCR_Srsx 15 287 6.1e-11 PFAM
Pfam:7tm_1 21 272 2e-67 PFAM
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency
MGI Phenotype Homozygotes for null mutations exhibit isoform dependent loss of behavioral and gastrointestinal opioid responses and may also show impaired spatial memory, heightened nociception, reduced locomotor activity, increased hematopoietic proliferation, and decreased male fertility.,NO_PHENOTYPE
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Bpifb9b A G 2: 154,319,675 N576D possibly damaging Het
Braf C T 6: 39,662,073 C248Y probably damaging Het
Carmil2 A G 8: 105,697,048 E1218G possibly damaging Het
Cntnap4 G T 8: 112,757,571 G419C probably damaging Het
Csmd3 CCTTTGCGCTT CCTT 15: 47,741,236 probably null Het
Dnah9 C T 11: 66,117,483 D839N probably damaging Het
Evc2 A G 5: 37,380,518 T517A possibly damaging Het
Fbxw8 G A 5: 118,124,988 P209S probably damaging Het
Gcm1 A G 9: 78,061,380 K121E probably benign Het
Gprc6a CAAA CA 10: 51,615,680 probably null Het
Herc2 A G 7: 56,212,922 D4077G probably benign Het
Inpp4b T A 8: 82,121,375 L937* probably null Het
Ipmk A G 10: 71,381,426 T267A probably benign Het
Jph3 G T 8: 121,753,231 R216L possibly damaging Het
Kctd16 A G 18: 40,259,085 E242G probably damaging Het
Klk14 G A 7: 43,692,077 C51Y probably damaging Het
Krt76 A G 15: 101,888,385 Y360H probably damaging Het
Lctl A G 9: 64,117,767 I12V probably benign Het
Lrig3 T C 10: 125,997,696 V347A possibly damaging Het
Lrrk2 C T 15: 91,796,060 S2058F probably damaging Het
Mark2 G C 19: 7,282,747 S111C probably damaging Het
Mon2 T A 10: 123,075,929 K12* probably null Het
Nupl1 A G 14: 60,239,508 V238A probably benign Het
Pak7 T C 2: 136,098,382 D504G probably benign Het
Pla2g4e T C 2: 120,185,206 S286G probably benign Het
Ppfia4 A T 1: 134,313,723 V498D probably benign Het
Ppfibp1 A G 6: 147,027,453 E846G probably damaging Het
Ppp3ca G A 3: 136,877,630 C166Y probably damaging Het
Prpf3 T C 3: 95,845,230 K244E probably benign Het
Pzp A G 6: 128,525,276 S37P probably damaging Het
Rab11fip3 G A 17: 26,069,054 H42Y probably benign Het
Sprn C A 7: 140,153,506 probably benign Het
Tectb C G 19: 55,180,999 probably benign Het
Thap12 A G 7: 98,710,126 S71G probably damaging Het
Vmn1r7 A G 6: 57,024,894 F127S probably damaging Het
Vmn2r54 C T 7: 12,615,493 V721I probably benign Het
Vmn2r56 A G 7: 12,694,219 F707L probably benign Het
Zfp976 C T 7: 42,613,930 S161N probably benign Het
Other mutations in Ipcef1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01018:Ipcef1 APN 10 6919968 missense probably damaging 1.00
IGL01018:Ipcef1 APN 10 6890551 missense probably benign
IGL01295:Ipcef1 APN 10 6900642 missense probably damaging 1.00
IGL01738:Ipcef1 APN 10 6890575 missense probably damaging 1.00
IGL03095:Ipcef1 APN 10 6919732 missense probably damaging 1.00
R0001:Ipcef1 UTSW 10 6900600 missense probably damaging 0.99
R0206:Ipcef1 UTSW 10 6920062 missense probably damaging 1.00
R0208:Ipcef1 UTSW 10 6920062 missense probably damaging 1.00
R1161:Ipcef1 UTSW 10 6980288 critical splice acceptor site probably null
R1496:Ipcef1 UTSW 10 6935173 critical splice donor site probably null
R1592:Ipcef1 UTSW 10 6935182 splice site probably null
R1829:Ipcef1 UTSW 10 6919900 missense probably benign 0.27
R1893:Ipcef1 UTSW 10 6900680 missense probably damaging 1.00
R2107:Ipcef1 UTSW 10 6890501 missense probably benign 0.01
R2413:Ipcef1 UTSW 10 6935225 missense probably damaging 1.00
R2655:Ipcef1 UTSW 10 6979657 missense probably benign 0.02
R2886:Ipcef1 UTSW 10 6900641 missense probably damaging 1.00
R4752:Ipcef1 UTSW 10 6979573 missense probably damaging 1.00
R5134:Ipcef1 UTSW 10 6919950 missense probably benign 0.03
R5800:Ipcef1 UTSW 10 6890569 missense probably damaging 1.00
R5938:Ipcef1 UTSW 10 6908029 unclassified probably benign
R5989:Ipcef1 UTSW 10 6979532 nonsense probably null
R7414:Ipcef1 UTSW 10 6890673 nonsense probably null
R7425:Ipcef1 UTSW 10 6956066 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTGCTCAAAGAGAATTTTCCACAC -3'
(R):5'- CAGCTTCTTATGGCTCCCACAG -3'

Sequencing Primer
(F):5'- TTTTCCACACAATCAGAAGACGTGG -3'
(R):5'- TGACCTCAGGCGTGTTGC -3'
Posted On2014-10-01