Incidental Mutation 'R2160:Ipmk'
ID235121
Institutional Source Beutler Lab
Gene Symbol Ipmk
Ensembl Gene ENSMUSG00000060733
Gene Nameinositol polyphosphate multikinase
Synonyms
MMRRC Submission 040163-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R2160 (G1)
Quality Score225
Status Not validated
Chromosome10
Chromosomal Location71347763-71433327 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 71381426 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 267 (T267A)
Ref Sequence ENSEMBL: ENSMUSP00000078240 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000079252] [ENSMUST00000118381] [ENSMUST00000121446] [ENSMUST00000147277]
Predicted Effect probably benign
Transcript: ENSMUST00000079252
AA Change: T267A

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000078240
Gene: ENSMUSG00000060733
AA Change: T267A

DomainStartEndE-ValueType
low complexity region 2 13 N/A INTRINSIC
Pfam:IPK 110 391 1.4e-69 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000118381
SMART Domains Protein: ENSMUSP00000113083
Gene: ENSMUSG00000060733

DomainStartEndE-ValueType
low complexity region 2 13 N/A INTRINSIC
Pfam:IPK 110 194 8.2e-33 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000121446
AA Change: T268A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000112568
Gene: ENSMUSG00000060733
AA Change: T268A

DomainStartEndE-ValueType
low complexity region 2 13 N/A INTRINSIC
Pfam:IPK 111 392 2.6e-70 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000141984
Predicted Effect probably benign
Transcript: ENSMUST00000147277
SMART Domains Protein: ENSMUSP00000120073
Gene: ENSMUSG00000060733

DomainStartEndE-ValueType
low complexity region 2 13 N/A INTRINSIC
Pfam:IPK 110 194 8.2e-33 PFAM
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the inositol phosphokinase family. The encoded protein has 3-kinase, 5-kinase and 6-kinase activities on phosphorylated inositol substrates. The encoded protein plays an important role in the biosynthesis of inositol 1,3,4,5,6-pentakisphosphate, and has a preferred 5-kinase activity. This gene may play a role in nuclear mRNA export. Pseudogenes of this gene are located on the long arm of chromosome 13 and the short arm of chromosome 19. [provided by RefSeq, Dec 2010]
PHENOTYPE: Homozygous null mice display embryonic lethality, reduced embryo size, delayed embryonic development, failure of chorioallantoic fusion and embryo turning, and a kinked and open neural tube. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Bpifb9b A G 2: 154,319,675 N576D possibly damaging Het
Braf C T 6: 39,662,073 C248Y probably damaging Het
Carmil2 A G 8: 105,697,048 E1218G possibly damaging Het
Cntnap4 G T 8: 112,757,571 G419C probably damaging Het
Csmd3 CCTTTGCGCTT CCTT 15: 47,741,236 probably null Het
Dnah9 C T 11: 66,117,483 D839N probably damaging Het
Evc2 A G 5: 37,380,518 T517A possibly damaging Het
Fbxw8 G A 5: 118,124,988 P209S probably damaging Het
Gcm1 A G 9: 78,061,380 K121E probably benign Het
Gprc6a CAAA CA 10: 51,615,680 probably null Het
Herc2 A G 7: 56,212,922 D4077G probably benign Het
Inpp4b T A 8: 82,121,375 L937* probably null Het
Ipcef1 A T 10: 6,890,650 I349N probably damaging Het
Jph3 G T 8: 121,753,231 R216L possibly damaging Het
Kctd16 A G 18: 40,259,085 E242G probably damaging Het
Klk14 G A 7: 43,692,077 C51Y probably damaging Het
Krt76 A G 15: 101,888,385 Y360H probably damaging Het
Lctl A G 9: 64,117,767 I12V probably benign Het
Lrig3 T C 10: 125,997,696 V347A possibly damaging Het
Lrrk2 C T 15: 91,796,060 S2058F probably damaging Het
Mark2 G C 19: 7,282,747 S111C probably damaging Het
Mon2 T A 10: 123,075,929 K12* probably null Het
Nupl1 A G 14: 60,239,508 V238A probably benign Het
Pak7 T C 2: 136,098,382 D504G probably benign Het
Pla2g4e T C 2: 120,185,206 S286G probably benign Het
Ppfia4 A T 1: 134,313,723 V498D probably benign Het
Ppfibp1 A G 6: 147,027,453 E846G probably damaging Het
Ppp3ca G A 3: 136,877,630 C166Y probably damaging Het
Prpf3 T C 3: 95,845,230 K244E probably benign Het
Pzp A G 6: 128,525,276 S37P probably damaging Het
Rab11fip3 G A 17: 26,069,054 H42Y probably benign Het
Sprn C A 7: 140,153,506 probably benign Het
Tectb C G 19: 55,180,999 probably benign Het
Thap12 A G 7: 98,710,126 S71G probably damaging Het
Vmn1r7 A G 6: 57,024,894 F127S probably damaging Het
Vmn2r54 C T 7: 12,615,493 V721I probably benign Het
Vmn2r56 A G 7: 12,694,219 F707L probably benign Het
Zfp976 C T 7: 42,613,930 S161N probably benign Het
Other mutations in Ipmk
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01382:Ipmk APN 10 71376766 missense probably damaging 0.99
IGL01524:Ipmk APN 10 71372801 missense probably damaging 1.00
IGL01872:Ipmk APN 10 71372876 missense probably damaging 1.00
I1329:Ipmk UTSW 10 71381447 missense possibly damaging 0.46
R0282:Ipmk UTSW 10 71372831 missense probably benign 0.06
R1477:Ipmk UTSW 10 71381777 missense probably damaging 1.00
R1759:Ipmk UTSW 10 71381303 missense probably damaging 1.00
R2042:Ipmk UTSW 10 71363503 missense probably damaging 1.00
R2070:Ipmk UTSW 10 71372749 nonsense probably null
R2520:Ipmk UTSW 10 71381217 missense probably damaging 1.00
R4570:Ipmk UTSW 10 71372739 missense probably benign 0.04
R5522:Ipmk UTSW 10 71363474 missense probably benign 0.30
R6941:Ipmk UTSW 10 71348090 missense probably null 1.00
R7198:Ipmk UTSW 10 71348052 missense probably damaging 1.00
R7203:Ipmk UTSW 10 71363468 missense possibly damaging 0.67
R7414:Ipmk UTSW 10 71381294 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- TTGCCGCCAGTATTCAGAAG -3'
(R):5'- AGTTGGGCAAGCACGTTTCC -3'

Sequencing Primer
(F):5'- CCGCCAGTATTCAGAAGGTAGAG -3'
(R):5'- AAGTGTTCCTGGGACATGC -3'
Posted On2014-10-01