Incidental Mutation 'R2160:Lrig3'
ID235123
Institutional Source Beutler Lab
Gene Symbol Lrig3
Ensembl Gene ENSMUSG00000020105
Gene Nameleucine-rich repeats and immunoglobulin-like domains 3
Synonyms9030421L11Rik, 9430095K15Rik, 9130004I02Rik
MMRRC Submission 040163-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.201) question?
Stock #R2160 (G1)
Quality Score225
Status Not validated
Chromosome10
Chromosomal Location125966168-126015359 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 125997696 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 347 (V347A)
Ref Sequence ENSEMBL: ENSMUSP00000074360 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000074807]
PDB Structure
Crystal structure of an Immunoglobulin I-set domain of Lrig3 protein (Lrig3) from MUS MUSCULUS at 1.70 A resolution [X-RAY DIFFRACTION]
Predicted Effect possibly damaging
Transcript: ENSMUST00000074807
AA Change: V347A

PolyPhen 2 Score 0.946 (Sensitivity: 0.80; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000074360
Gene: ENSMUSG00000020105
AA Change: V347A

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
LRRNT 46 78 6.74e-2 SMART
LRR 72 96 4.45e1 SMART
LRR 97 120 1.06e1 SMART
LRR 144 166 1.14e0 SMART
LRR 168 189 1.62e2 SMART
LRR 190 214 1.09e1 SMART
LRR 215 237 1.71e1 SMART
LRR 238 261 2.29e0 SMART
LRR 262 285 3.07e-1 SMART
LRR 286 309 2.49e-1 SMART
LRR 310 333 1.29e1 SMART
LRR 334 357 6.22e0 SMART
LRR 358 384 6.05e0 SMART
LRR_TYP 385 408 1.56e-2 SMART
LRR_TYP 409 432 1.79e-2 SMART
LRRCT 444 494 2.35e-7 SMART
IGc2 511 588 1.65e-4 SMART
IGc2 615 683 1.33e-8 SMART
IGc2 709 774 2.78e-11 SMART
transmembrane domain 805 827 N/A INTRINSIC
low complexity region 1069 1081 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000217813
Predicted Effect noncoding transcript
Transcript: ENSMUST00000218593
Predicted Effect noncoding transcript
Transcript: ENSMUST00000220332
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a null allele or severely hypomorphic gene trap allele exhibit fusion of the lateral semicircular canal and circling behavior. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Bpifb9b A G 2: 154,319,675 N576D possibly damaging Het
Braf C T 6: 39,662,073 C248Y probably damaging Het
Carmil2 A G 8: 105,697,048 E1218G possibly damaging Het
Cntnap4 G T 8: 112,757,571 G419C probably damaging Het
Csmd3 CCTTTGCGCTT CCTT 15: 47,741,236 probably null Het
Dnah9 C T 11: 66,117,483 D839N probably damaging Het
Evc2 A G 5: 37,380,518 T517A possibly damaging Het
Fbxw8 G A 5: 118,124,988 P209S probably damaging Het
Gcm1 A G 9: 78,061,380 K121E probably benign Het
Gprc6a CAAA CA 10: 51,615,680 probably null Het
Herc2 A G 7: 56,212,922 D4077G probably benign Het
Inpp4b T A 8: 82,121,375 L937* probably null Het
Ipcef1 A T 10: 6,890,650 I349N probably damaging Het
Ipmk A G 10: 71,381,426 T267A probably benign Het
Jph3 G T 8: 121,753,231 R216L possibly damaging Het
Kctd16 A G 18: 40,259,085 E242G probably damaging Het
Klk14 G A 7: 43,692,077 C51Y probably damaging Het
Krt76 A G 15: 101,888,385 Y360H probably damaging Het
Lctl A G 9: 64,117,767 I12V probably benign Het
Lrrk2 C T 15: 91,796,060 S2058F probably damaging Het
Mark2 G C 19: 7,282,747 S111C probably damaging Het
Mon2 T A 10: 123,075,929 K12* probably null Het
Nupl1 A G 14: 60,239,508 V238A probably benign Het
Pak7 T C 2: 136,098,382 D504G probably benign Het
Pla2g4e T C 2: 120,185,206 S286G probably benign Het
Ppfia4 A T 1: 134,313,723 V498D probably benign Het
Ppfibp1 A G 6: 147,027,453 E846G probably damaging Het
Ppp3ca G A 3: 136,877,630 C166Y probably damaging Het
Prpf3 T C 3: 95,845,230 K244E probably benign Het
Pzp A G 6: 128,525,276 S37P probably damaging Het
Rab11fip3 G A 17: 26,069,054 H42Y probably benign Het
Sprn C A 7: 140,153,506 probably benign Het
Tectb C G 19: 55,180,999 probably benign Het
Thap12 A G 7: 98,710,126 S71G probably damaging Het
Vmn1r7 A G 6: 57,024,894 F127S probably damaging Het
Vmn2r54 C T 7: 12,615,493 V721I probably benign Het
Vmn2r56 A G 7: 12,694,219 F707L probably benign Het
Zfp976 C T 7: 42,613,930 S161N probably benign Het
Other mutations in Lrig3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00333:Lrig3 APN 10 126013148 missense probably benign 0.00
IGL00426:Lrig3 APN 10 125972137 nonsense probably null
IGL00969:Lrig3 APN 10 125997115 missense probably damaging 1.00
IGL01376:Lrig3 APN 10 125994466 missense probably benign 0.01
IGL01510:Lrig3 APN 10 126008698 missense probably damaging 1.00
IGL01825:Lrig3 APN 10 126010017 missense probably damaging 0.98
IGL02231:Lrig3 APN 10 125997172 missense probably damaging 1.00
IGL02377:Lrig3 APN 10 126014874 missense probably benign 0.00
IGL02648:Lrig3 APN 10 125966594 missense probably benign
IGL02832:Lrig3 APN 10 126007002 missense probably benign 0.37
IGL03266:Lrig3 APN 10 126013282 missense probably benign 0.28
R0023:Lrig3 UTSW 10 126010219 missense probably damaging 1.00
R0129:Lrig3 UTSW 10 126006943 missense probably damaging 1.00
R0183:Lrig3 UTSW 10 126010192 missense probably damaging 1.00
R0226:Lrig3 UTSW 10 125972117 splice site probably benign
R0233:Lrig3 UTSW 10 126013526 splice site probably null
R0233:Lrig3 UTSW 10 126013526 splice site probably null
R0336:Lrig3 UTSW 10 125966705 missense probably benign 0.04
R0348:Lrig3 UTSW 10 126013448 nonsense probably null
R0502:Lrig3 UTSW 10 126008736 missense probably damaging 1.00
R0639:Lrig3 UTSW 10 126010221 missense probably damaging 1.00
R1099:Lrig3 UTSW 10 126007014 splice site probably null
R1220:Lrig3 UTSW 10 125997076 missense probably damaging 1.00
R1230:Lrig3 UTSW 10 126002971 missense probably damaging 1.00
R1398:Lrig3 UTSW 10 126003088 missense probably benign 0.00
R1451:Lrig3 UTSW 10 126010057 missense possibly damaging 0.92
R1523:Lrig3 UTSW 10 126008698 missense probably damaging 1.00
R1545:Lrig3 UTSW 10 126008547 missense possibly damaging 0.80
R1661:Lrig3 UTSW 10 125997701 missense probably benign 0.12
R1665:Lrig3 UTSW 10 125997701 missense probably benign 0.12
R1673:Lrig3 UTSW 10 126010167 missense probably damaging 1.00
R1778:Lrig3 UTSW 10 126010075 missense probably damaging 1.00
R1800:Lrig3 UTSW 10 125997051 splice site probably null
R1840:Lrig3 UTSW 10 126013389 nonsense probably null
R1882:Lrig3 UTSW 10 126009825 missense possibly damaging 0.89
R1900:Lrig3 UTSW 10 126002393 splice site probably benign
R2200:Lrig3 UTSW 10 125996609 splice site probably null
R2294:Lrig3 UTSW 10 125966494 nonsense probably null
R2518:Lrig3 UTSW 10 125994441 missense probably benign 0.07
R3037:Lrig3 UTSW 10 126010032 missense probably damaging 1.00
R3236:Lrig3 UTSW 10 125997187 missense probably damaging 1.00
R4073:Lrig3 UTSW 10 126013408 missense probably benign
R4074:Lrig3 UTSW 10 126013408 missense probably benign
R4075:Lrig3 UTSW 10 126013408 missense probably benign
R4077:Lrig3 UTSW 10 126009787 missense probably damaging 1.00
R4079:Lrig3 UTSW 10 126009787 missense probably damaging 1.00
R4405:Lrig3 UTSW 10 126011008 missense probably benign 0.00
R4425:Lrig3 UTSW 10 126013404 missense probably benign 0.00
R4505:Lrig3 UTSW 10 126013347 missense probably benign 0.00
R4860:Lrig3 UTSW 10 126011052 missense probably benign 0.36
R4860:Lrig3 UTSW 10 126011052 missense probably benign 0.36
R4903:Lrig3 UTSW 10 125996613 critical splice acceptor site probably null
R5201:Lrig3 UTSW 10 126013151 missense possibly damaging 0.48
R5307:Lrig3 UTSW 10 126006690 missense probably damaging 1.00
R5402:Lrig3 UTSW 10 126008740 missense probably damaging 1.00
R5557:Lrig3 UTSW 10 125972134 missense probably damaging 1.00
R5792:Lrig3 UTSW 10 126009919 missense probably damaging 1.00
R5903:Lrig3 UTSW 10 126008478 missense probably damaging 1.00
R6280:Lrig3 UTSW 10 126010979 missense probably benign 0.18
R6484:Lrig3 UTSW 10 125996609 splice site probably null
R6985:Lrig3 UTSW 10 126014869 missense possibly damaging 0.64
R7089:Lrig3 UTSW 10 125997124 missense probably damaging 1.00
R7177:Lrig3 UTSW 10 126006843 missense probably benign 0.02
R7347:Lrig3 UTSW 10 126009966 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AATGTTTACCTGGTTACTGTAAGGC -3'
(R):5'- GCCCACTTTTGAGGCTGTAC -3'

Sequencing Primer
(F):5'- GGCAGAATGTTAAAACAGGATTATTG -3'
(R):5'- GAGGCTGTACACATTTCCTCAAC -3'
Posted On2014-10-01