Mutagenetix > Incidental Mutation

Incidental Mutation 'R2160:Lrrk2'

235131

Institutional Source

Beutler Lab

Gene Symbol

Lrrk2

Ensembl Gene

ENSMUSG00000036273

Gene Name

leucine-rich repeat kinase 2

Synonyms

4921513O20Rik, cI-46, D630001M17Rik, 9330188B09Rik, LOC381026

MMRRC Submission

040163-MU

Accession Numbers

Essential gene?

Possibly non essential (E-score: 0.451) question?

Stock #

R2160 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

91557378-91700323 bp(+) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 91680263 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Serine to Phenylalanine at position 2058 (S2058F)

Ref Sequence

ENSEMBL: ENSMUSP00000052584 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000060642]

AlphaFold

Q5S006

Predicted Effect

probably damaging
Transcript: ENSMUST00000060642
AA Change: S2058F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000052584
Gene: ENSMUSG00000036273
AA Change: S2058F

Domain	Start	End	E-Value	Type
low complexity region	138	156	N/A	INTRINSIC
low complexity region	332	347	N/A	INTRINSIC
ANK	708	737	3.95e1	SMART
ANK	770	800	4.58e2	SMART
low complexity region	890	901	N/A	INTRINSIC
low complexity region	953	966	N/A	INTRINSIC
low complexity region	971	979	N/A	INTRINSIC
LRR	1010	1033	9.96e-1	SMART
LRR	1034	1057	8.01e0	SMART
LRR	1082	1105	2.45e0	SMART
LRR	1128	1151	9.3e-1	SMART
LRR	1195	1219	3.24e0	SMART
LRR	1244	1266	3.87e1	SMART
LRR	1267	1291	4.98e1	SMART
Pfam:Roc	1336	1456	4.9e-32	PFAM
Pfam:Ras	1336	1489	3.3e-17	PFAM
Pfam:COR	1524	1740	4e-28	PFAM
Pfam:Pkinase	1881	2132	4.7e-40	PFAM
Pfam:Pkinase_Tyr	1882	2132	6.8e-39	PFAM
WD40	2231	2276	3.09e-1	SMART
WD40	2401	2438	1.37e2	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000133743

Coding Region Coverage

1x: 99.3%
3x: 98.7%
10x: 97.4%
20x: 95.5%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the leucine-rich repeat kinase family and encodes a protein with an ankryin repeat region, a leucine-rich repeat (LRR) domain, a kinase domain, a DFG-like motif, a RAS domain, a GTPase domain, a MLK-like domain, and a WD40 domain. The protein is present largely in the cytoplasm but also associates with the mitochondrial outer membrane. Mutations in this gene have been associated with Parkinson disease-8. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-in allele exhibit impaired response to dopamine, amphetamine, and quinpirole. Mice homozygous for one knock-out allele exhibit increased neurite growth. Mice homozygous for different knock-out alleles exhibit alopecia due to excessive grooming or kdiney atrophy. [provided by MGI curators]

Allele List at MGI

All alleles(7) : Targeted, knock-out(6) Targeted, other(1)

Other mutations in this stock

Total: 38 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Bpifb9b	A	G	2: 154,161,595 (GRCm39)	N576D	possibly damaging	Het
Braf	C	T	6: 39,639,007 (GRCm39)	C248Y	probably damaging	Het
Carmil2	A	G	8: 106,423,680 (GRCm39)	E1218G	possibly damaging	Het
Cntnap4	G	T	8: 113,484,203 (GRCm39)	G419C	probably damaging	Het
Csmd3	CCTTTGCGCTT	CCTT	15: 47,604,632 (GRCm39)		probably null	Het
Dnah9	C	T	11: 66,008,309 (GRCm39)	D839N	probably damaging	Het
Evc2	A	G	5: 37,537,862 (GRCm39)	T517A	possibly damaging	Het
Fbxw8	G	A	5: 118,263,053 (GRCm39)	P209S	probably damaging	Het
Gcm1	A	G	9: 77,968,662 (GRCm39)	K121E	probably benign	Het
Gprc6a	CAAA	CA	10: 51,491,776 (GRCm39)		probably null	Het
Herc2	A	G	7: 55,862,670 (GRCm39)	D4077G	probably benign	Het
Inpp4b	T	A	8: 82,848,004 (GRCm39)	L937*	probably null	Het
Ipcef1	A	T	10: 6,840,650 (GRCm39)	I349N	probably damaging	Het
Ipmk	A	G	10: 71,217,256 (GRCm39)	T267A	probably benign	Het
Jph3	G	T	8: 122,479,970 (GRCm39)	R216L	possibly damaging	Het
Kctd16	A	G	18: 40,392,138 (GRCm39)	E242G	probably damaging	Het
Klk14	G	A	7: 43,341,501 (GRCm39)	C51Y	probably damaging	Het
Krt76	A	G	15: 101,796,820 (GRCm39)	Y360H	probably damaging	Het
Lctl	A	G	9: 64,025,049 (GRCm39)	I12V	probably benign	Het
Lrig3	T	C	10: 125,833,565 (GRCm39)	V347A	possibly damaging	Het
Mark2	G	C	19: 7,260,112 (GRCm39)	S111C	probably damaging	Het
Mon2	T	A	10: 122,911,834 (GRCm39)	K12*	probably null	Het
Nup58	A	G	14: 60,476,957 (GRCm39)	V238A	probably benign	Het
Pak5	T	C	2: 135,940,302 (GRCm39)	D504G	probably benign	Het
Pla2g4e	T	C	2: 120,015,687 (GRCm39)	S286G	probably benign	Het
Ppfia4	A	T	1: 134,241,461 (GRCm39)	V498D	probably benign	Het
Ppfibp1	A	G	6: 146,928,951 (GRCm39)	E846G	probably damaging	Het
Ppp3ca	G	A	3: 136,583,391 (GRCm39)	C166Y	probably damaging	Het
Prpf3	T	C	3: 95,752,542 (GRCm39)	K244E	probably benign	Het
Pzp	A	G	6: 128,502,239 (GRCm39)	S37P	probably damaging	Het
Rab11fip3	G	A	17: 26,288,028 (GRCm39)	H42Y	probably benign	Het
Sprn	C	A	7: 139,733,419 (GRCm39)		probably benign	Het
Tectb	C	G	19: 55,169,431 (GRCm39)		probably benign	Het
Thap12	A	G	7: 98,359,333 (GRCm39)	S71G	probably damaging	Het
Vmn1r7	A	G	6: 57,001,879 (GRCm39)	F127S	probably damaging	Het
Vmn2r54	C	T	7: 12,349,420 (GRCm39)	V721I	probably benign	Het
Vmn2r56	A	G	7: 12,428,146 (GRCm39)	F707L	probably benign	Het
Zfp976	C	T	7: 42,263,354 (GRCm39)	S161N	probably benign	Het

Other mutations in Lrrk2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00159:Lrrk2	APN	15	91,632,002 (GRCm39)	missense	possibly damaging	0.90
IGL00542:Lrrk2	APN	15	91,584,146 (GRCm39)	missense	probably benign
IGL00770:Lrrk2	APN	15	91,686,036 (GRCm39)	splice site	probably benign
IGL00774:Lrrk2	APN	15	91,686,036 (GRCm39)	splice site	probably benign
IGL00791:Lrrk2	APN	15	91,664,044 (GRCm39)	missense	probably damaging	1.00
IGL00827:Lrrk2	APN	15	91,639,993 (GRCm39)	missense	probably damaging	1.00
IGL00843:Lrrk2	APN	15	91,641,261 (GRCm39)	missense	possibly damaging	0.58
IGL01109:Lrrk2	APN	15	91,623,035 (GRCm39)	missense	probably damaging	1.00
IGL01293:Lrrk2	APN	15	91,610,340 (GRCm39)	missense	probably benign	0.21
IGL01296:Lrrk2	APN	15	91,567,345 (GRCm39)	missense	probably benign
IGL01301:Lrrk2	APN	15	91,651,542 (GRCm39)	missense	probably damaging	1.00
IGL01360:Lrrk2	APN	15	91,584,772 (GRCm39)	splice site	probably null
IGL01465:Lrrk2	APN	15	91,613,128 (GRCm39)	missense	probably benign	0.21
IGL01529:Lrrk2	APN	15	91,696,516 (GRCm39)	missense	possibly damaging	0.92
IGL01557:Lrrk2	APN	15	91,584,192 (GRCm39)	missense	probably damaging	1.00
IGL01560:Lrrk2	APN	15	91,659,191 (GRCm39)	missense	probably benign	0.33
IGL01991:Lrrk2	APN	15	91,664,149 (GRCm39)	missense	probably damaging	0.99
IGL02003:Lrrk2	APN	15	91,615,694 (GRCm39)	missense	probably damaging	0.99
IGL02325:Lrrk2	APN	15	91,610,511 (GRCm39)	critical splice donor site	probably null
IGL02711:Lrrk2	APN	15	91,570,025 (GRCm39)	missense	possibly damaging	0.71
IGL02869:Lrrk2	APN	15	91,634,480 (GRCm39)	missense	probably damaging	1.00
IGL03104:Lrrk2	APN	15	91,631,958 (GRCm39)	missense	possibly damaging	0.68
IGL03179:Lrrk2	APN	15	91,584,781 (GRCm39)	missense	probably damaging	1.00
IGL03395:Lrrk2	APN	15	91,681,617 (GRCm39)	splice site	probably null
horned	UTSW	15	91,657,061 (GRCm39)	missense	probably damaging	1.00
R1312_Lrrk2_980	UTSW	15	91,584,098 (GRCm39)	missense	probably damaging	1.00
R4710_lrrk2_232	UTSW	15	91,584,130 (GRCm39)	missense	possibly damaging	0.88
R5245_Lrrk2_127	UTSW	15	91,680,292 (GRCm39)	missense	probably damaging	1.00
spree	UTSW	15	91,586,450 (GRCm39)	missense	probably benign	0.00
Spur	UTSW	15	91,659,198 (GRCm39)	nonsense	probably null
3-1:Lrrk2	UTSW	15	91,686,137 (GRCm39)	missense	probably benign	0.01
ANU18:Lrrk2	UTSW	15	91,651,542 (GRCm39)	missense	probably damaging	1.00
H8562:Lrrk2	UTSW	15	91,557,561 (GRCm39)	missense	probably benign
H8786:Lrrk2	UTSW	15	91,557,561 (GRCm39)	missense	probably benign
IGL02835:Lrrk2	UTSW	15	91,698,863 (GRCm39)	critical splice acceptor site	probably null
R0014:Lrrk2	UTSW	15	91,686,248 (GRCm39)	splice site	probably benign
R0014:Lrrk2	UTSW	15	91,686,248 (GRCm39)	splice site	probably benign
R0078:Lrrk2	UTSW	15	91,618,212 (GRCm39)	missense	probably benign	0.01
R0100:Lrrk2	UTSW	15	91,629,999 (GRCm39)	missense	probably damaging	1.00
R0282:Lrrk2	UTSW	15	91,662,617 (GRCm39)	splice site	probably benign
R0448:Lrrk2	UTSW	15	91,593,508 (GRCm39)	missense	probably damaging	0.99
R0449:Lrrk2	UTSW	15	91,634,478 (GRCm39)	missense	probably damaging	1.00
R0610:Lrrk2	UTSW	15	91,699,619 (GRCm39)	missense	probably benign
R0617:Lrrk2	UTSW	15	91,636,481 (GRCm39)	missense	probably benign	0.00
R0632:Lrrk2	UTSW	15	91,680,231 (GRCm39)	missense	probably damaging	0.98
R0639:Lrrk2	UTSW	15	91,657,199 (GRCm39)	missense	probably benign	0.03
R0661:Lrrk2	UTSW	15	91,671,219 (GRCm39)	missense	probably damaging	1.00
R0666:Lrrk2	UTSW	15	91,641,273 (GRCm39)	critical splice donor site	probably null
R0764:Lrrk2	UTSW	15	91,659,249 (GRCm39)	splice site	probably null
R0766:Lrrk2	UTSW	15	91,584,098 (GRCm39)	missense	probably damaging	1.00
R0845:Lrrk2	UTSW	15	91,640,165 (GRCm39)	missense	probably benign	0.22
R0940:Lrrk2	UTSW	15	91,613,284 (GRCm39)	missense	possibly damaging	0.83
R0970:Lrrk2	UTSW	15	91,613,372 (GRCm39)	missense	probably benign	0.22
R1080:Lrrk2	UTSW	15	91,557,892 (GRCm39)	missense	probably benign	0.01
R1114:Lrrk2	UTSW	15	91,584,671 (GRCm39)	nonsense	probably null
R1223:Lrrk2	UTSW	15	91,557,838 (GRCm39)	missense	probably benign	0.00
R1289:Lrrk2	UTSW	15	91,696,563 (GRCm39)	missense	probably benign	0.00
R1296:Lrrk2	UTSW	15	91,613,123 (GRCm39)	missense	probably damaging	1.00
R1312:Lrrk2	UTSW	15	91,584,098 (GRCm39)	missense	probably damaging	1.00
R1637:Lrrk2	UTSW	15	91,618,261 (GRCm39)	missense	probably benign
R1773:Lrrk2	UTSW	15	91,664,184 (GRCm39)	missense	possibly damaging	0.96
R1809:Lrrk2	UTSW	15	91,584,095 (GRCm39)	missense	possibly damaging	0.86
R1839:Lrrk2	UTSW	15	91,567,337 (GRCm39)	missense	probably benign	0.00
R1946:Lrrk2	UTSW	15	91,620,864 (GRCm39)	splice site	probably null
R2232:Lrrk2	UTSW	15	91,648,919 (GRCm39)	missense	probably benign	0.05
R2419:Lrrk2	UTSW	15	91,681,729 (GRCm39)	splice site	probably benign
R2516:Lrrk2	UTSW	15	91,640,130 (GRCm39)	missense	probably benign
R3110:Lrrk2	UTSW	15	91,698,898 (GRCm39)	missense	probably benign	0.02
R3112:Lrrk2	UTSW	15	91,698,898 (GRCm39)	missense	probably benign	0.02
R3801:Lrrk2	UTSW	15	91,621,314 (GRCm39)	missense	probably benign
R3842:Lrrk2	UTSW	15	91,640,119 (GRCm39)	missense	probably benign	0.01
R3903:Lrrk2	UTSW	15	91,631,904 (GRCm39)	missense	probably damaging	1.00
R3903:Lrrk2	UTSW	15	91,631,903 (GRCm39)	missense	probably damaging	1.00
R3930:Lrrk2	UTSW	15	91,651,664 (GRCm39)	critical splice donor site	probably null
R3937:Lrrk2	UTSW	15	91,662,707 (GRCm39)	missense	probably damaging	0.98
R3938:Lrrk2	UTSW	15	91,662,707 (GRCm39)	missense	probably damaging	0.98
R3938:Lrrk2	UTSW	15	91,596,983 (GRCm39)	missense	possibly damaging	0.69
R3982:Lrrk2	UTSW	15	91,593,487 (GRCm39)	missense	probably benign	0.22
R4125:Lrrk2	UTSW	15	91,699,686 (GRCm39)	missense	probably benign	0.01
R4130:Lrrk2	UTSW	15	91,639,997 (GRCm39)	missense	probably benign	0.19
R4296:Lrrk2	UTSW	15	91,584,098 (GRCm39)	missense	probably damaging	1.00
R4465:Lrrk2	UTSW	15	91,632,023 (GRCm39)	missense	probably damaging	0.96
R4478:Lrrk2	UTSW	15	91,607,391 (GRCm39)	missense	probably damaging	1.00
R4517:Lrrk2	UTSW	15	91,589,323 (GRCm39)	missense	probably benign
R4539:Lrrk2	UTSW	15	91,613,345 (GRCm39)	missense	possibly damaging	0.86
R4654:Lrrk2	UTSW	15	91,649,884 (GRCm39)	missense	probably damaging	0.96
R4710:Lrrk2	UTSW	15	91,584,130 (GRCm39)	missense	possibly damaging	0.88
R4722:Lrrk2	UTSW	15	91,573,104 (GRCm39)	missense	probably damaging	1.00
R4723:Lrrk2	UTSW	15	91,648,962 (GRCm39)	missense	probably damaging	1.00
R4732:Lrrk2	UTSW	15	91,649,950 (GRCm39)	missense	probably damaging	1.00
R4732:Lrrk2	UTSW	15	91,573,052 (GRCm39)	missense	probably damaging	1.00
R4733:Lrrk2	UTSW	15	91,649,950 (GRCm39)	missense	probably damaging	1.00
R4733:Lrrk2	UTSW	15	91,573,052 (GRCm39)	missense	probably damaging	1.00
R4787:Lrrk2	UTSW	15	91,597,031 (GRCm39)	missense	probably benign
R4945:Lrrk2	UTSW	15	91,689,123 (GRCm39)	missense	probably benign	0.02
R4948:Lrrk2	UTSW	15	91,687,592 (GRCm39)	missense	probably benign	0.20
R5000:Lrrk2	UTSW	15	91,634,081 (GRCm39)	missense	probably damaging	1.00
R5031:Lrrk2	UTSW	15	91,584,822 (GRCm39)	missense	possibly damaging	0.50
R5067:Lrrk2	UTSW	15	91,649,993 (GRCm39)	missense	probably benign	0.01
R5245:Lrrk2	UTSW	15	91,680,292 (GRCm39)	missense	probably damaging	1.00
R5341:Lrrk2	UTSW	15	91,657,061 (GRCm39)	missense	probably damaging	1.00
R5460:Lrrk2	UTSW	15	91,698,847 (GRCm39)	splice site	probably null
R5551:Lrrk2	UTSW	15	91,696,553 (GRCm39)	missense	probably benign
R5574:Lrrk2	UTSW	15	91,671,219 (GRCm39)	missense	probably damaging	1.00
R5577:Lrrk2	UTSW	15	91,649,948 (GRCm39)	missense	probably damaging	1.00
R5685:Lrrk2	UTSW	15	91,687,504 (GRCm39)	nonsense	probably null
R5712:Lrrk2	UTSW	15	91,586,425 (GRCm39)	nonsense	probably null
R5728:Lrrk2	UTSW	15	91,659,177 (GRCm39)	missense	probably benign	0.36
R5782:Lrrk2	UTSW	15	91,586,386 (GRCm39)	missense	probably damaging	1.00
R5788:Lrrk2	UTSW	15	91,648,851 (GRCm39)	missense	possibly damaging	0.55
R5821:Lrrk2	UTSW	15	91,593,593 (GRCm39)	critical splice donor site	probably null
R5852:Lrrk2	UTSW	15	91,640,152 (GRCm39)	missense	probably damaging	1.00
R5934:Lrrk2	UTSW	15	91,618,249 (GRCm39)	missense	probably benign	0.00
R5935:Lrrk2	UTSW	15	91,630,034 (GRCm39)	missense	probably benign	0.14
R5979:Lrrk2	UTSW	15	91,657,148 (GRCm39)	missense	possibly damaging	0.47
R6101:Lrrk2	UTSW	15	91,607,338 (GRCm39)	missense	probably benign	0.10
R6114:Lrrk2	UTSW	15	91,632,029 (GRCm39)	missense	probably benign	0.33
R6259:Lrrk2	UTSW	15	91,586,450 (GRCm39)	missense	probably benign	0.00
R6376:Lrrk2	UTSW	15	91,626,469 (GRCm39)	missense	possibly damaging	0.89
R6417:Lrrk2	UTSW	15	91,696,549 (GRCm39)	missense	probably benign	0.03
R6420:Lrrk2	UTSW	15	91,696,549 (GRCm39)	missense	probably benign	0.03
R6737:Lrrk2	UTSW	15	91,607,421 (GRCm39)	missense	possibly damaging	0.50
R7056:Lrrk2	UTSW	15	91,659,198 (GRCm39)	nonsense	probably null
R7072:Lrrk2	UTSW	15	91,686,123 (GRCm39)	missense	probably benign	0.03
R7109:Lrrk2	UTSW	15	91,648,985 (GRCm39)	missense	probably damaging	1.00
R7128:Lrrk2	UTSW	15	91,686,088 (GRCm39)	missense	probably benign
R7144:Lrrk2	UTSW	15	91,618,258 (GRCm39)	missense	possibly damaging	0.54
R7187:Lrrk2	UTSW	15	91,641,204 (GRCm39)	missense	possibly damaging	0.92
R7270:Lrrk2	UTSW	15	91,584,644 (GRCm39)	missense	probably benign	0.01
R7356:Lrrk2	UTSW	15	91,622,947 (GRCm39)	missense	probably benign	0.07
R7360:Lrrk2	UTSW	15	91,615,858 (GRCm39)	critical splice donor site	probably null
R7373:Lrrk2	UTSW	15	91,584,207 (GRCm39)	critical splice donor site	probably null
R7465:Lrrk2	UTSW	15	91,651,543 (GRCm39)	missense	probably damaging	1.00
R7477:Lrrk2	UTSW	15	91,696,528 (GRCm39)	missense	probably damaging	0.98
R7614:Lrrk2	UTSW	15	91,657,061 (GRCm39)	missense	probably damaging	1.00
R7622:Lrrk2	UTSW	15	91,696,526 (GRCm39)	missense	probably damaging	1.00
R7658:Lrrk2	UTSW	15	91,584,561 (GRCm39)	missense	possibly damaging	0.91
R7679:Lrrk2	UTSW	15	91,610,389 (GRCm39)	missense	possibly damaging	0.58
R7737:Lrrk2	UTSW	15	91,699,649 (GRCm39)	missense	probably damaging	0.98
R7739:Lrrk2	UTSW	15	91,584,816 (GRCm39)	missense	probably damaging	1.00
R7740:Lrrk2	UTSW	15	91,651,527 (GRCm39)	missense	probably damaging	1.00
R7908:Lrrk2	UTSW	15	91,610,355 (GRCm39)	missense	probably damaging	1.00
R8299:Lrrk2	UTSW	15	91,557,443 (GRCm39)	start gained	probably benign
R8389:Lrrk2	UTSW	15	91,584,194 (GRCm39)	missense	probably damaging	1.00
R8462:Lrrk2	UTSW	15	91,615,680 (GRCm39)	missense	probably benign
R8698:Lrrk2	UTSW	15	91,636,400 (GRCm39)	missense	probably benign	0.38
R8947:Lrrk2	UTSW	15	91,586,473 (GRCm39)	nonsense	probably null
R9084:Lrrk2	UTSW	15	91,634,469 (GRCm39)	missense
R9086:Lrrk2	UTSW	15	91,640,051 (GRCm39)	missense	probably benign	0.01
R9096:Lrrk2	UTSW	15	91,557,459 (GRCm39)	start gained	probably benign
R9097:Lrrk2	UTSW	15	91,557,459 (GRCm39)	start gained	probably benign
R9267:Lrrk2	UTSW	15	91,584,629 (GRCm39)	missense	probably damaging	0.99
R9285:Lrrk2	UTSW	15	91,662,686 (GRCm39)	missense	probably damaging	1.00
R9341:Lrrk2	UTSW	15	91,584,618 (GRCm39)	missense	probably benign	0.18
R9343:Lrrk2	UTSW	15	91,584,618 (GRCm39)	missense	probably benign	0.18
R9371:Lrrk2	UTSW	15	91,607,407 (GRCm39)	missense	probably damaging	1.00
R9424:Lrrk2	UTSW	15	91,636,388 (GRCm39)	nonsense	probably null
R9489:Lrrk2	UTSW	15	91,621,420 (GRCm39)	missense	probably benign	0.37
R9502:Lrrk2	UTSW	15	91,607,365 (GRCm39)	missense	probably damaging	0.98
R9563:Lrrk2	UTSW	15	91,634,043 (GRCm39)	missense	possibly damaging	0.90
R9576:Lrrk2	UTSW	15	91,636,388 (GRCm39)	nonsense	probably null
R9605:Lrrk2	UTSW	15	91,621,420 (GRCm39)	missense	probably benign	0.37
R9635:Lrrk2	UTSW	15	91,696,527 (GRCm39)	missense	probably benign	0.21
R9641:Lrrk2	UTSW	15	91,671,251 (GRCm39)	missense	possibly damaging	0.94
R9660:Lrrk2	UTSW	15	91,618,228 (GRCm39)	missense	probably benign	0.00
R9673:Lrrk2	UTSW	15	91,649,884 (GRCm39)	missense	probably damaging	1.00
R9708:Lrrk2	UTSW	15	91,634,482 (GRCm39)	nonsense	probably null
R9728:Lrrk2	UTSW	15	91,618,228 (GRCm39)	missense	probably benign	0.00
R9757:Lrrk2	UTSW	15	91,695,229 (GRCm39)	missense	probably benign	0.03
RF001:Lrrk2	UTSW	15	91,620,836 (GRCm39)	missense	probably benign	0.11
X0028:Lrrk2	UTSW	15	91,623,054 (GRCm39)	missense	probably benign	0.00
Z1088:Lrrk2	UTSW	15	91,610,443 (GRCm39)	missense	probably benign	0.12

Predicted Primers

PCR Primer
(F):5'- GCTCACTGACTTCTTCCAGG -3'
(R):5'- TGCACTCAGCCAAAGTCATC -3'

Sequencing Primer
(F):5'- TTACTGCAGCAATGACCTGG -3'
(R):5'- TCAAACTCTACATGACCAAGCTG -3'

Posted On

2014-10-01