Incidental Mutation 'R2161:Ndufa8'
ID235141
Institutional Source Beutler Lab
Gene Symbol Ndufa8
Ensembl Gene ENSMUSG00000026895
Gene NameNADH dehydrogenase (ubiquinone) 1 alpha subcomplex, 8
Synonyms0610033L03Rik
MMRRC Submission 040164-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.677) question?
Stock #R2161 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location36036326-36049406 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 36036515 bp
ZygosityHeterozygous
Amino Acid Change Tryptophan to Arginine at position 170 (W170R)
Ref Sequence ENSEMBL: ENSMUSP00000065352 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000070112]
Predicted Effect probably damaging
Transcript: ENSMUST00000070112
AA Change: W170R

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000065352
Gene: ENSMUSG00000026895
AA Change: W170R

DomainStartEndE-ValueType
low complexity region 5 29 N/A INTRINSIC
Pfam:CHCH 78 113 3.6e-10 PFAM
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the complex I 19 kDa subunit family. Mammalian complex I is composed of 45 different subunits. This protein has NADH dehydrogenase activity and oxidoreductase activity. It plays an important role in transfering electrons from NADH to the respiratory chain. The immediate electron acceptor for the enzyme is believed to be ubiquinone. Alternative splicing of this gene results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Dec 2015]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
6430573F11Rik T C 8: 36,505,650 C85R probably damaging Het
Adamts12 A G 15: 11,215,735 M281V probably damaging Het
Ap1g1 A T 8: 109,844,354 D423V probably damaging Het
Arel1 A G 12: 84,921,256 probably null Het
Arhgap33 T C 7: 30,528,650 probably null Het
Arhgef18 T G 8: 3,439,575 Y302* probably null Het
Blm T C 7: 80,481,370 probably null Het
Cep295 T G 9: 15,353,058 E97D probably damaging Het
Cep295nl T C 11: 118,332,509 D503G possibly damaging Het
Chchd2 G T 5: 129,884,148 A29E probably damaging Het
Cic A G 7: 25,288,134 probably null Het
Cmtr1 C T 17: 29,702,173 L798F probably benign Het
Col11a2 C A 17: 34,064,797 probably benign Het
Crispld2 A G 8: 120,015,339 Y142C probably damaging Het
Csmd3 CCTTTGCGCTT CCTT 15: 47,741,236 probably null Het
Dsp G A 13: 38,196,451 D1792N probably damaging Het
Esp4 C A 17: 40,602,393 N50K probably benign Het
Fbxo21 T C 5: 117,995,386 S404P probably damaging Het
Ggnbp2 A G 11: 84,834,433 F639L probably benign Het
Golph3l G A 3: 95,617,125 G229D probably damaging Het
Hlx G T 1: 184,727,641 S433R probably benign Het
Kdm2b T A 5: 122,880,699 S233C probably damaging Het
Krt14 C T 11: 100,207,113 G115R unknown Het
Ldb3 A G 14: 34,567,396 probably null Het
Lrp1 T A 10: 127,555,738 E2937D probably damaging Het
Mark2 G C 19: 7,282,747 S111C probably damaging Het
Naa20 T A 2: 145,911,795 probably null Het
Nlrp2 A T 7: 5,325,042 L671I probably damaging Het
Olfr1462 T A 19: 13,191,309 I214K probably damaging Het
Olfr603 T A 7: 103,383,200 R267S probably benign Het
Ptgir A G 7: 16,906,869 M29V possibly damaging Het
Ptpro A G 6: 137,449,887 D280G probably benign Het
Reps1 A G 10: 18,096,283 E361G probably damaging Het
Rgs6 A G 12: 83,091,804 E304G probably damaging Het
Siglece T C 7: 43,659,369 T187A probably benign Het
Slc5a10 C T 11: 61,719,934 G5R probably null Het
Sohlh1 A G 2: 25,844,636 I215T probably benign Het
Stag1 T A 9: 100,889,595 V691D probably damaging Het
Tectb C G 19: 55,180,999 probably benign Het
Tmed8 A G 12: 87,174,257 V185A probably damaging Het
Trim71 A G 9: 114,512,772 F814S probably damaging Het
Tsnax A T 8: 125,015,689 K52N probably damaging Het
Tubgcp3 T C 8: 12,632,292 T676A probably benign Het
Other mutations in Ndufa8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00095:Ndufa8 APN 2 36044455 missense probably damaging 0.99
IGL02603:Ndufa8 APN 2 36044458 missense probably damaging 1.00
R0322:Ndufa8 UTSW 2 36036622 missense probably benign 0.11
R2287:Ndufa8 UTSW 2 36036542 missense probably benign 0.36
R3001:Ndufa8 UTSW 2 36036559 missense possibly damaging 0.83
R3002:Ndufa8 UTSW 2 36036559 missense possibly damaging 0.83
R6186:Ndufa8 UTSW 2 36039740 missense probably benign 0.16
R7068:Ndufa8 UTSW 2 36044435 missense possibly damaging 0.95
Predicted Primers PCR Primer
(F):5'- AGGGGAAGTCATCTTTAAAGGC -3'
(R):5'- CAAGAGTCTCTTTGAACCCTGAC -3'

Sequencing Primer
(F):5'- GGAAGTCATCTTTAAAGGCTAAAAGG -3'
(R):5'- GAACCCTGACTCTCTTCTTCG -3'
Posted On2014-10-01