Incidental Mutation 'R2161:Golph3l'
ID235143
Institutional Source Beutler Lab
Gene Symbol Golph3l
Ensembl Gene ENSMUSG00000046519
Gene Namegolgi phosphoprotein 3-like
Synonyms2010204I15Rik, GPP34R
MMRRC Submission 040164-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.154) question?
Stock #R2161 (G1)
Quality Score225
Status Not validated
Chromosome3
Chromosomal Location95588934-95619247 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 95617125 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Aspartic acid at position 229 (G229D)
Ref Sequence ENSEMBL: ENSMUSP00000096460 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000060323] [ENSMUST00000098861] [ENSMUST00000177390]
Predicted Effect probably damaging
Transcript: ENSMUST00000060323
AA Change: G166D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000058654
Gene: ENSMUSG00000046519
AA Change: G166D

DomainStartEndE-ValueType
Pfam:GPP34 50 275 8.5e-54 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000098861
AA Change: G229D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000096460
Gene: ENSMUSG00000046519
AA Change: G229D

DomainStartEndE-ValueType
low complexity region 58 69 N/A INTRINSIC
low complexity region 72 83 N/A INTRINSIC
Pfam:GPP34 106 277 5.1e-51 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000176541
Predicted Effect unknown
Transcript: ENSMUST00000176674
AA Change: G184D
SMART Domains Protein: ENSMUSP00000134885
Gene: ENSMUSG00000046519
AA Change: G184D

DomainStartEndE-ValueType
low complexity region 58 69 N/A INTRINSIC
low complexity region 72 83 N/A INTRINSIC
Pfam:GPP34 104 288 2.4e-39 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000176755
AA Change: G226D
SMART Domains Protein: ENSMUSP00000134804
Gene: ENSMUSG00000046519
AA Change: G226D

DomainStartEndE-ValueType
low complexity region 56 67 N/A INTRINSIC
low complexity region 70 81 N/A INTRINSIC
Pfam:GPP34 104 275 7.5e-51 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000177389
AA Change: G165D
Predicted Effect probably damaging
Transcript: ENSMUST00000177390
AA Change: G229D

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000134799
Gene: ENSMUSG00000046519
AA Change: G229D

DomainStartEndE-ValueType
low complexity region 58 69 N/A INTRINSIC
low complexity region 72 83 N/A INTRINSIC
Pfam:GPP34 106 332 8.3e-61 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000177399
AA Change: G66D
SMART Domains Protein: ENSMUSP00000134998
Gene: ENSMUSG00000046519
AA Change: G66D

DomainStartEndE-ValueType
Pfam:GPP34 23 170 5.4e-27 PFAM
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The Golgi complex plays a key role in the sorting and modification of proteins exported from the endoplasmic reticulum. The protein encoded by this gene is localized at the Golgi stack and may have a regulatory role in Golgi trafficking. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
6430573F11Rik T C 8: 36,505,650 C85R probably damaging Het
Adamts12 A G 15: 11,215,735 M281V probably damaging Het
Ap1g1 A T 8: 109,844,354 D423V probably damaging Het
Arel1 A G 12: 84,921,256 probably null Het
Arhgap33 T C 7: 30,528,650 probably null Het
Arhgef18 T G 8: 3,439,575 Y302* probably null Het
Blm T C 7: 80,481,370 probably null Het
Cep295 T G 9: 15,353,058 E97D probably damaging Het
Cep295nl T C 11: 118,332,509 D503G possibly damaging Het
Chchd2 G T 5: 129,884,148 A29E probably damaging Het
Cic A G 7: 25,288,134 probably null Het
Cmtr1 C T 17: 29,702,173 L798F probably benign Het
Col11a2 C A 17: 34,064,797 probably benign Het
Crispld2 A G 8: 120,015,339 Y142C probably damaging Het
Csmd3 CCTTTGCGCTT CCTT 15: 47,741,236 probably null Het
Dsp G A 13: 38,196,451 D1792N probably damaging Het
Esp4 C A 17: 40,602,393 N50K probably benign Het
Fbxo21 T C 5: 117,995,386 S404P probably damaging Het
Ggnbp2 A G 11: 84,834,433 F639L probably benign Het
Hlx G T 1: 184,727,641 S433R probably benign Het
Kdm2b T A 5: 122,880,699 S233C probably damaging Het
Krt14 C T 11: 100,207,113 G115R unknown Het
Ldb3 A G 14: 34,567,396 probably null Het
Lrp1 T A 10: 127,555,738 E2937D probably damaging Het
Mark2 G C 19: 7,282,747 S111C probably damaging Het
Naa20 T A 2: 145,911,795 probably null Het
Ndufa8 A T 2: 36,036,515 W170R probably damaging Het
Nlrp2 A T 7: 5,325,042 L671I probably damaging Het
Olfr1462 T A 19: 13,191,309 I214K probably damaging Het
Olfr603 T A 7: 103,383,200 R267S probably benign Het
Ptgir A G 7: 16,906,869 M29V possibly damaging Het
Ptpro A G 6: 137,449,887 D280G probably benign Het
Reps1 A G 10: 18,096,283 E361G probably damaging Het
Rgs6 A G 12: 83,091,804 E304G probably damaging Het
Siglece T C 7: 43,659,369 T187A probably benign Het
Slc5a10 C T 11: 61,719,934 G5R probably null Het
Sohlh1 A G 2: 25,844,636 I215T probably benign Het
Stag1 T A 9: 100,889,595 V691D probably damaging Het
Tectb C G 19: 55,180,999 probably benign Het
Tmed8 A G 12: 87,174,257 V185A probably damaging Het
Trim71 A G 9: 114,512,772 F814S probably damaging Het
Tsnax A T 8: 125,015,689 K52N probably damaging Het
Tubgcp3 T C 8: 12,632,292 T676A probably benign Het
Other mutations in Golph3l
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00583:Golph3l APN 3 95589103 missense possibly damaging 0.96
IGL01299:Golph3l APN 3 95617277 missense possibly damaging 0.71
R0749:Golph3l UTSW 3 95607949 missense probably damaging 1.00
R2021:Golph3l UTSW 3 95617357 missense probably benign 0.01
R2359:Golph3l UTSW 3 95591964 intron probably null
R3015:Golph3l UTSW 3 95591713 intron probably benign
R4828:Golph3l UTSW 3 95591748 missense possibly damaging 0.63
R4933:Golph3l UTSW 3 95617423 missense probably benign 0.00
R5088:Golph3l UTSW 3 95617190 missense possibly damaging 0.55
R6132:Golph3l UTSW 3 95591834 missense probably benign 0.30
R6339:Golph3l UTSW 3 95617439 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGGCATGTTCCTCCATGGATG -3'
(R):5'- TCCAGCACATCAGAAGAGTGG -3'

Sequencing Primer
(F):5'- CAGAGGTCTTGAGTTCAATTCCCAG -3'
(R):5'- AAGAGTGGGCCAGCACC -3'
Posted On2014-10-01