Incidental Mutation 'R2161:Arhgap33'
ID235151
Institutional Source Beutler Lab
Gene Symbol Arhgap33
Ensembl Gene ENSMUSG00000036882
Gene NameRho GTPase activating protein 33
SynonymsSnx26, NOMA-GAP, Tcgap
MMRRC Submission 040164-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.255) question?
Stock #R2161 (G1)
Quality Score211
Status Not validated
Chromosome7
Chromosomal Location30522226-30535060 bp(-) (GRCm38)
Type of Mutationsplice site (4 bp from exon)
DNA Base Change (assembly) T to C at 30528650 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000146767 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044338] [ENSMUST00000207858] [ENSMUST00000207860] [ENSMUST00000208491] [ENSMUST00000208522] [ENSMUST00000208538]
Predicted Effect probably null
Transcript: ENSMUST00000044338
SMART Domains Protein: ENSMUSP00000038412
Gene: ENSMUSG00000036882

DomainStartEndE-ValueType
low complexity region 45 58 N/A INTRINSIC
SH3 213 271 5.32e-12 SMART
low complexity region 318 335 N/A INTRINSIC
RhoGAP 350 531 4.05e-67 SMART
low complexity region 582 595 N/A INTRINSIC
low complexity region 597 609 N/A INTRINSIC
low complexity region 675 686 N/A INTRINSIC
low complexity region 694 733 N/A INTRINSIC
low complexity region 770 798 N/A INTRINSIC
low complexity region 832 850 N/A INTRINSIC
low complexity region 894 940 N/A INTRINSIC
low complexity region 979 988 N/A INTRINSIC
low complexity region 1076 1086 N/A INTRINSIC
low complexity region 1158 1166 N/A INTRINSIC
low complexity region 1194 1216 N/A INTRINSIC
low complexity region 1284 1291 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000207637
Predicted Effect probably null
Transcript: ENSMUST00000207858
Predicted Effect probably null
Transcript: ENSMUST00000207860
Predicted Effect probably null
Transcript: ENSMUST00000208491
Predicted Effect probably null
Transcript: ENSMUST00000208522
Predicted Effect probably null
Transcript: ENSMUST00000208538
Predicted Effect noncoding transcript
Transcript: ENSMUST00000208723
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the sorting nexin family. Members of this family contain a phox (PX) domain, which is a phosphoinositide binding domain, and are involved in intracellular trafficking. Alternative splice variants encoding different isoforms have been identified in this gene. [provided by RefSeq, Feb 2010]
PHENOTYPE: Mice homozygous for a null mutation display region specific thinning of the cerebral cortex with reduced dendritic complexity. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
6430573F11Rik T C 8: 36,505,650 C85R probably damaging Het
Adamts12 A G 15: 11,215,735 M281V probably damaging Het
Ap1g1 A T 8: 109,844,354 D423V probably damaging Het
Arel1 A G 12: 84,921,256 probably null Het
Arhgef18 T G 8: 3,439,575 Y302* probably null Het
Blm T C 7: 80,481,370 probably null Het
Cep295 T G 9: 15,353,058 E97D probably damaging Het
Cep295nl T C 11: 118,332,509 D503G possibly damaging Het
Chchd2 G T 5: 129,884,148 A29E probably damaging Het
Cic A G 7: 25,288,134 probably null Het
Cmtr1 C T 17: 29,702,173 L798F probably benign Het
Col11a2 C A 17: 34,064,797 probably benign Het
Crispld2 A G 8: 120,015,339 Y142C probably damaging Het
Csmd3 CCTTTGCGCTT CCTT 15: 47,741,236 probably null Het
Dsp G A 13: 38,196,451 D1792N probably damaging Het
Esp4 C A 17: 40,602,393 N50K probably benign Het
Fbxo21 T C 5: 117,995,386 S404P probably damaging Het
Ggnbp2 A G 11: 84,834,433 F639L probably benign Het
Golph3l G A 3: 95,617,125 G229D probably damaging Het
Hlx G T 1: 184,727,641 S433R probably benign Het
Kdm2b T A 5: 122,880,699 S233C probably damaging Het
Krt14 C T 11: 100,207,113 G115R unknown Het
Ldb3 A G 14: 34,567,396 probably null Het
Lrp1 T A 10: 127,555,738 E2937D probably damaging Het
Mark2 G C 19: 7,282,747 S111C probably damaging Het
Naa20 T A 2: 145,911,795 probably null Het
Ndufa8 A T 2: 36,036,515 W170R probably damaging Het
Nlrp2 A T 7: 5,325,042 L671I probably damaging Het
Olfr1462 T A 19: 13,191,309 I214K probably damaging Het
Olfr603 T A 7: 103,383,200 R267S probably benign Het
Ptgir A G 7: 16,906,869 M29V possibly damaging Het
Ptpro A G 6: 137,449,887 D280G probably benign Het
Reps1 A G 10: 18,096,283 E361G probably damaging Het
Rgs6 A G 12: 83,091,804 E304G probably damaging Het
Siglece T C 7: 43,659,369 T187A probably benign Het
Slc5a10 C T 11: 61,719,934 G5R probably null Het
Sohlh1 A G 2: 25,844,636 I215T probably benign Het
Stag1 T A 9: 100,889,595 V691D probably damaging Het
Tectb C G 19: 55,180,999 probably benign Het
Tmed8 A G 12: 87,174,257 V185A probably damaging Het
Trim71 A G 9: 114,512,772 F814S probably damaging Het
Tsnax A T 8: 125,015,689 K52N probably damaging Het
Tubgcp3 T C 8: 12,632,292 T676A probably benign Het
Other mutations in Arhgap33
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01092:Arhgap33 APN 7 30529946 missense probably damaging 0.99
IGL02176:Arhgap33 APN 7 30524051 missense possibly damaging 0.76
IGL02430:Arhgap33 APN 7 30522760 missense probably benign 0.07
IGL03091:Arhgap33 APN 7 30528293 missense probably damaging 1.00
R0276:Arhgap33 UTSW 7 30523244 missense probably benign 0.01
R0494:Arhgap33 UTSW 7 30524496 missense probably damaging 0.98
R0597:Arhgap33 UTSW 7 30526446 missense probably damaging 1.00
R0717:Arhgap33 UTSW 7 30528349 missense probably damaging 1.00
R1661:Arhgap33 UTSW 7 30532323 missense probably damaging 1.00
R1761:Arhgap33 UTSW 7 30533063 intron probably null
R1882:Arhgap33 UTSW 7 30522809 missense probably damaging 1.00
R2566:Arhgap33 UTSW 7 30527229 missense probably damaging 1.00
R4353:Arhgap33 UTSW 7 30524136 missense possibly damaging 0.95
R4552:Arhgap33 UTSW 7 30519108 unclassified probably benign
R4778:Arhgap33 UTSW 7 30532093 missense probably benign
R4887:Arhgap33 UTSW 7 30532192 missense probably damaging 0.99
R4957:Arhgap33 UTSW 7 30532361 missense probably damaging 0.96
R5001:Arhgap33 UTSW 7 30533016 missense possibly damaging 0.95
R5140:Arhgap33 UTSW 7 30528301 missense probably damaging 1.00
R5585:Arhgap33 UTSW 7 30523835 missense probably benign 0.00
R5704:Arhgap33 UTSW 7 30519620 unclassified probably benign
R5805:Arhgap33 UTSW 7 30526414 missense probably benign 0.01
R6476:Arhgap33 UTSW 7 30524412 missense probably damaging 0.99
R6485:Arhgap33 UTSW 7 30524004 missense probably benign
R6572:Arhgap33 UTSW 7 30527210 missense probably damaging 1.00
X0034:Arhgap33 UTSW 7 30524449 small deletion probably benign
Predicted Primers PCR Primer
(F):5'- TGAGATGCCCTTCTTGACTCTG -3'
(R):5'- GTGAGCGAGATGAACTTCTCC -3'

Sequencing Primer
(F):5'- CTGCCCATTTACCTGTAGTGTGG -3'
(R):5'- AGCGAGATGAACTTCTCCTTGCTG -3'
Posted On2014-10-01