Incidental Mutation 'R2161:Siglece'
ID235152
Institutional Source Beutler Lab
Gene Symbol Siglece
Ensembl Gene ENSMUSG00000030474
Gene Namesialic acid binding Ig-like lectin E
SynonymsSiglecl1, Siglec5, mSiglec-E
MMRRC Submission 040164-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.027) question?
Stock #R2161 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location43651070-43660161 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 43659369 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 187 (T187A)
Ref Sequence ENSEMBL: ENSMUSP00000032667 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032667]
Predicted Effect probably benign
Transcript: ENSMUST00000032667
AA Change: T187A

PolyPhen 2 Score 0.013 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000032667
Gene: ENSMUSG00000030474
AA Change: T187A

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
IG 30 146 1.52e-3 SMART
IG 155 239 4.15e0 SMART
IGc2 269 330 6.81e-6 SMART
transmembrane domain 352 374 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000206421
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele or a knock-in allele that destroys the sialic acid binding site exhibit increased neutrophil and macrophage recruitment in an LPS-induced model of acute lung ariway inflammation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
6430573F11Rik T C 8: 36,505,650 C85R probably damaging Het
Adamts12 A G 15: 11,215,735 M281V probably damaging Het
Ap1g1 A T 8: 109,844,354 D423V probably damaging Het
Arel1 A G 12: 84,921,256 probably null Het
Arhgap33 T C 7: 30,528,650 probably null Het
Arhgef18 T G 8: 3,439,575 Y302* probably null Het
Blm T C 7: 80,481,370 probably null Het
Cep295 T G 9: 15,353,058 E97D probably damaging Het
Cep295nl T C 11: 118,332,509 D503G possibly damaging Het
Chchd2 G T 5: 129,884,148 A29E probably damaging Het
Cic A G 7: 25,288,134 probably null Het
Cmtr1 C T 17: 29,702,173 L798F probably benign Het
Col11a2 C A 17: 34,064,797 probably benign Het
Crispld2 A G 8: 120,015,339 Y142C probably damaging Het
Csmd3 CCTTTGCGCTT CCTT 15: 47,741,236 probably null Het
Dsp G A 13: 38,196,451 D1792N probably damaging Het
Esp4 C A 17: 40,602,393 N50K probably benign Het
Fbxo21 T C 5: 117,995,386 S404P probably damaging Het
Ggnbp2 A G 11: 84,834,433 F639L probably benign Het
Golph3l G A 3: 95,617,125 G229D probably damaging Het
Hlx G T 1: 184,727,641 S433R probably benign Het
Kdm2b T A 5: 122,880,699 S233C probably damaging Het
Krt14 C T 11: 100,207,113 G115R unknown Het
Ldb3 A G 14: 34,567,396 probably null Het
Lrp1 T A 10: 127,555,738 E2937D probably damaging Het
Mark2 G C 19: 7,282,747 S111C probably damaging Het
Naa20 T A 2: 145,911,795 probably null Het
Ndufa8 A T 2: 36,036,515 W170R probably damaging Het
Nlrp2 A T 7: 5,325,042 L671I probably damaging Het
Olfr1462 T A 19: 13,191,309 I214K probably damaging Het
Olfr603 T A 7: 103,383,200 R267S probably benign Het
Ptgir A G 7: 16,906,869 M29V possibly damaging Het
Ptpro A G 6: 137,449,887 D280G probably benign Het
Reps1 A G 10: 18,096,283 E361G probably damaging Het
Rgs6 A G 12: 83,091,804 E304G probably damaging Het
Slc5a10 C T 11: 61,719,934 G5R probably null Het
Sohlh1 A G 2: 25,844,636 I215T probably benign Het
Stag1 T A 9: 100,889,595 V691D probably damaging Het
Tectb C G 19: 55,180,999 probably benign Het
Tmed8 A G 12: 87,174,257 V185A probably damaging Het
Trim71 A G 9: 114,512,772 F814S probably damaging Het
Tsnax A T 8: 125,015,689 K52N probably damaging Het
Tubgcp3 T C 8: 12,632,292 T676A probably benign Het
Other mutations in Siglece
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0502:Siglece UTSW 7 43659931 missense probably damaging 1.00
R1766:Siglece UTSW 7 43651532 missense probably damaging 0.99
R1772:Siglece UTSW 7 43659293 missense probably damaging 1.00
R1853:Siglece UTSW 7 43659936 missense probably benign 0.01
R1854:Siglece UTSW 7 43659936 missense probably benign 0.01
R1914:Siglece UTSW 7 43657795 missense probably benign 0.03
R2060:Siglece UTSW 7 43657786 missense probably benign 0.25
R4461:Siglece UTSW 7 43651505 missense probably benign 0.00
R4924:Siglece UTSW 7 43659873 missense probably damaging 1.00
R4975:Siglece UTSW 7 43658972 critical splice donor site probably null
R5864:Siglece UTSW 7 43659317 missense probably damaging 1.00
R5956:Siglece UTSW 7 43659336 missense probably damaging 0.99
R7111:Siglece UTSW 7 43659903 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- CAGCCTCACATGACACGTTGAG -3'
(R):5'- AGCAGCTGGGTTTGAGCATC -3'

Sequencing Primer
(F):5'- GACGGATGGTCATTCTTGTGGAC -3'
(R):5'- AGCTGGATCAGAGCCGG -3'
Posted On2014-10-01