Incidental Mutation 'R2161:6430573F11Rik'
ID235156
Institutional Source Beutler Lab
Gene Symbol 6430573F11Rik
Ensembl Gene ENSMUSG00000039620
Gene NameRIKEN cDNA 6430573F11 gene
Synonyms
MMRRC Submission 040164-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.179) question?
Stock #R2161 (G1)
Quality Score225
Status Not validated
Chromosome8
Chromosomal Location36457548-36516570 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 36505650 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Arginine at position 85 (C85R)
Ref Sequence ENSEMBL: ENSMUSP00000127875 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000135373] [ENSMUST00000147525] [ENSMUST00000152039] [ENSMUST00000171777]
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125492
Predicted Effect possibly damaging
Transcript: ENSMUST00000135373
AA Change: C85R

PolyPhen 2 Score 0.788 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000120524
Gene: ENSMUSG00000039620
AA Change: C85R

DomainStartEndE-ValueType
Pfam:Methyltransf_11 49 114 7.7e-9 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000147525
AA Change: C85R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000119912
Gene: ENSMUSG00000039620
AA Change: C85R

DomainStartEndE-ValueType
Pfam:Methyltransf_8 4 158 3.6e-9 PFAM
Pfam:Ubie_methyltran 9 153 2.9e-7 PFAM
Pfam:Methyltransf_23 23 184 4.2e-12 PFAM
Pfam:Methyltransf_31 42 186 1.3e-10 PFAM
Pfam:Methyltransf_25 48 135 4.2e-9 PFAM
Pfam:Methyltransf_12 49 137 4.1e-11 PFAM
Pfam:Methyltransf_11 49 139 3.6e-18 PFAM
low complexity region 377 387 N/A INTRINSIC
low complexity region 410 430 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000152039
AA Change: C85R

PolyPhen 2 Score 0.615 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000119288
Gene: ENSMUSG00000039620
AA Change: C85R

DomainStartEndE-ValueType
Pfam:Methyltransf_11 49 109 2.9e-8 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000171777
AA Change: C85R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000127875
Gene: ENSMUSG00000039620
AA Change: C85R

DomainStartEndE-ValueType
Pfam:Methyltransf_8 4 158 3.6e-9 PFAM
Pfam:Ubie_methyltran 9 153 2.9e-7 PFAM
Pfam:Methyltransf_23 23 186 1.5e-11 PFAM
Pfam:Methyltransf_31 42 186 3.5e-10 PFAM
Pfam:Methyltransf_25 48 135 4.3e-9 PFAM
Pfam:Methyltransf_12 49 137 4.1e-11 PFAM
Pfam:Methyltransf_11 49 139 3.2e-18 PFAM
low complexity region 377 387 N/A INTRINSIC
low complexity region 410 430 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts12 A G 15: 11,215,735 M281V probably damaging Het
Ap1g1 A T 8: 109,844,354 D423V probably damaging Het
Arel1 A G 12: 84,921,256 probably null Het
Arhgap33 T C 7: 30,528,650 probably null Het
Arhgef18 T G 8: 3,439,575 Y302* probably null Het
Blm T C 7: 80,481,370 probably null Het
Cep295 T G 9: 15,353,058 E97D probably damaging Het
Cep295nl T C 11: 118,332,509 D503G possibly damaging Het
Chchd2 G T 5: 129,884,148 A29E probably damaging Het
Cic A G 7: 25,288,134 probably null Het
Cmtr1 C T 17: 29,702,173 L798F probably benign Het
Col11a2 C A 17: 34,064,797 probably benign Het
Crispld2 A G 8: 120,015,339 Y142C probably damaging Het
Csmd3 CCTTTGCGCTT CCTT 15: 47,741,236 probably null Het
Dsp G A 13: 38,196,451 D1792N probably damaging Het
Esp4 C A 17: 40,602,393 N50K probably benign Het
Fbxo21 T C 5: 117,995,386 S404P probably damaging Het
Ggnbp2 A G 11: 84,834,433 F639L probably benign Het
Golph3l G A 3: 95,617,125 G229D probably damaging Het
Hlx G T 1: 184,727,641 S433R probably benign Het
Kdm2b T A 5: 122,880,699 S233C probably damaging Het
Krt14 C T 11: 100,207,113 G115R unknown Het
Ldb3 A G 14: 34,567,396 probably null Het
Lrp1 T A 10: 127,555,738 E2937D probably damaging Het
Mark2 G C 19: 7,282,747 S111C probably damaging Het
Naa20 T A 2: 145,911,795 probably null Het
Ndufa8 A T 2: 36,036,515 W170R probably damaging Het
Nlrp2 A T 7: 5,325,042 L671I probably damaging Het
Olfr1462 T A 19: 13,191,309 I214K probably damaging Het
Olfr603 T A 7: 103,383,200 R267S probably benign Het
Ptgir A G 7: 16,906,869 M29V possibly damaging Het
Ptpro A G 6: 137,449,887 D280G probably benign Het
Reps1 A G 10: 18,096,283 E361G probably damaging Het
Rgs6 A G 12: 83,091,804 E304G probably damaging Het
Siglece T C 7: 43,659,369 T187A probably benign Het
Slc5a10 C T 11: 61,719,934 G5R probably null Het
Sohlh1 A G 2: 25,844,636 I215T probably benign Het
Stag1 T A 9: 100,889,595 V691D probably damaging Het
Tectb C G 19: 55,180,999 probably benign Het
Tmed8 A G 12: 87,174,257 V185A probably damaging Het
Trim71 A G 9: 114,512,772 F814S probably damaging Het
Tsnax A T 8: 125,015,689 K52N probably damaging Het
Tubgcp3 T C 8: 12,632,292 T676A probably benign Het
Other mutations in 6430573F11Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00518:6430573F11Rik APN 8 36512299 missense possibly damaging 0.90
IGL01360:6430573F11Rik APN 8 36512559 missense probably benign 0.08
IGL01364:6430573F11Rik APN 8 36512347 missense probably benign 0.03
IGL03401:6430573F11Rik APN 8 36505669 missense probably damaging 1.00
Bear_market UTSW 8 36498483 critical splice donor site probably null
R2230:6430573F11Rik UTSW 8 36512553 missense probably damaging 1.00
R2232:6430573F11Rik UTSW 8 36512553 missense probably damaging 1.00
R4250:6430573F11Rik UTSW 8 36512212 missense probably benign 0.05
R4432:6430573F11Rik UTSW 8 36498478 missense probably damaging 1.00
R4491:6430573F11Rik UTSW 8 36505606 missense probably damaging 1.00
R5242:6430573F11Rik UTSW 8 36511930 missense probably benign 0.02
R5261:6430573F11Rik UTSW 8 36511924 missense probably benign 0.07
R5482:6430573F11Rik UTSW 8 36512049 missense probably benign
R5579:6430573F11Rik UTSW 8 36512041 missense probably benign 0.00
R5594:6430573F11Rik UTSW 8 36512298 missense probably benign 0.00
R5797:6430573F11Rik UTSW 8 36498415 nonsense probably null
R6481:6430573F11Rik UTSW 8 36498483 critical splice donor site probably null
X0057:6430573F11Rik UTSW 8 36511988 nonsense probably null
X0065:6430573F11Rik UTSW 8 36511856 missense possibly damaging 0.71
Predicted Primers PCR Primer
(F):5'- AAGTGTTCTCTGAAGTGTTGCATC -3'
(R):5'- CAGGAGTCAAATAAGTCATGCG -3'

Sequencing Primer
(F):5'- AAGTGTTGCATCTTGGTCATTTAC -3'
(R):5'- ATGATAGCATCGAAGCCC -3'
Posted On2014-10-01