Incidental Mutation 'R2161:Crispld2'
ID235158
Institutional Source Beutler Lab
Gene Symbol Crispld2
Ensembl Gene ENSMUSG00000031825
Gene Namecysteine-rich secretory protein LCCL domain containing 2
Synonyms1810049K24Rik, Lgl1, coffeecrisp
MMRRC Submission 040164-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.401) question?
Stock #R2161 (G1)
Quality Score225
Status Not validated
Chromosome8
Chromosomal Location119992438-120052793 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 120015339 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 142 (Y142C)
Ref Sequence ENSEMBL: ENSMUSP00000122962 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034282] [ENSMUST00000108972] [ENSMUST00000127664] [ENSMUST00000132583]
Predicted Effect probably damaging
Transcript: ENSMUST00000034282
AA Change: Y142C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000034282
Gene: ENSMUSG00000031825
AA Change: Y142C

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
SCP 54 208 1.2e-48 SMART
LCCL 284 368 1.25e-45 SMART
LCCL 385 477 1.28e-51 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000108972
AA Change: Y142C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000104600
Gene: ENSMUSG00000031825
AA Change: Y142C

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
SCP 54 208 1.2e-48 SMART
LCCL 283 367 1.25e-45 SMART
LCCL 384 476 1.28e-51 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000127664
SMART Domains Protein: ENSMUSP00000118564
Gene: ENSMUSG00000092329

DomainStartEndE-ValueType
Pfam:Glycos_transf_2 104 287 7.4e-31 PFAM
Pfam:Glyco_transf_7C 261 331 4.9e-8 PFAM
RICIN 406 531 9.28e-27 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000132583
AA Change: Y142C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000122962
Gene: ENSMUSG00000031825
AA Change: Y142C

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
SCP 54 208 1.2e-48 SMART
LCCL 283 367 1.25e-45 SMART
LCCL 384 476 1.28e-51 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151629
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency
MGI Phenotype PHENOTYPE: Homozygous mutant mice show various immunological abnormalities, enhanced glucose tolerance and decreased bone-related measurements. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
6430573F11Rik T C 8: 36,505,650 C85R probably damaging Het
Adamts12 A G 15: 11,215,735 M281V probably damaging Het
Ap1g1 A T 8: 109,844,354 D423V probably damaging Het
Arel1 A G 12: 84,921,256 probably null Het
Arhgap33 T C 7: 30,528,650 probably null Het
Arhgef18 T G 8: 3,439,575 Y302* probably null Het
Blm T C 7: 80,481,370 probably null Het
Cep295 T G 9: 15,353,058 E97D probably damaging Het
Cep295nl T C 11: 118,332,509 D503G possibly damaging Het
Chchd2 G T 5: 129,884,148 A29E probably damaging Het
Cic A G 7: 25,288,134 probably null Het
Cmtr1 C T 17: 29,702,173 L798F probably benign Het
Col11a2 C A 17: 34,064,797 probably benign Het
Csmd3 CCTTTGCGCTT CCTT 15: 47,741,236 probably null Het
Dsp G A 13: 38,196,451 D1792N probably damaging Het
Esp4 C A 17: 40,602,393 N50K probably benign Het
Fbxo21 T C 5: 117,995,386 S404P probably damaging Het
Ggnbp2 A G 11: 84,834,433 F639L probably benign Het
Golph3l G A 3: 95,617,125 G229D probably damaging Het
Hlx G T 1: 184,727,641 S433R probably benign Het
Kdm2b T A 5: 122,880,699 S233C probably damaging Het
Krt14 C T 11: 100,207,113 G115R unknown Het
Ldb3 A G 14: 34,567,396 probably null Het
Lrp1 T A 10: 127,555,738 E2937D probably damaging Het
Mark2 G C 19: 7,282,747 S111C probably damaging Het
Naa20 T A 2: 145,911,795 probably null Het
Ndufa8 A T 2: 36,036,515 W170R probably damaging Het
Nlrp2 A T 7: 5,325,042 L671I probably damaging Het
Olfr1462 T A 19: 13,191,309 I214K probably damaging Het
Olfr603 T A 7: 103,383,200 R267S probably benign Het
Ptgir A G 7: 16,906,869 M29V possibly damaging Het
Ptpro A G 6: 137,449,887 D280G probably benign Het
Reps1 A G 10: 18,096,283 E361G probably damaging Het
Rgs6 A G 12: 83,091,804 E304G probably damaging Het
Siglece T C 7: 43,659,369 T187A probably benign Het
Slc5a10 C T 11: 61,719,934 G5R probably null Het
Sohlh1 A G 2: 25,844,636 I215T probably benign Het
Stag1 T A 9: 100,889,595 V691D probably damaging Het
Tectb C G 19: 55,180,999 probably benign Het
Tmed8 A G 12: 87,174,257 V185A probably damaging Het
Trim71 A G 9: 114,512,772 F814S probably damaging Het
Tsnax A T 8: 125,015,689 K52N probably damaging Het
Tubgcp3 T C 8: 12,632,292 T676A probably benign Het
Other mutations in Crispld2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00430:Crispld2 APN 8 120033560 missense probably damaging 1.00
IGL00835:Crispld2 APN 8 120010648 missense probably damaging 1.00
IGL03209:Crispld2 APN 8 120031098 missense possibly damaging 0.88
IGL03324:Crispld2 APN 8 120015371 missense probably damaging 1.00
R0172:Crispld2 UTSW 8 120026071 missense possibly damaging 0.80
R0212:Crispld2 UTSW 8 120010631 missense probably benign
R0492:Crispld2 UTSW 8 120026067 missense probably benign 0.30
R1532:Crispld2 UTSW 8 120023572 missense probably benign
R1715:Crispld2 UTSW 8 120023649 missense possibly damaging 0.75
R1865:Crispld2 UTSW 8 120010567 missense probably benign 0.00
R1953:Crispld2 UTSW 8 120015296 missense probably damaging 1.00
R2306:Crispld2 UTSW 8 120026071 missense probably damaging 0.99
R2851:Crispld2 UTSW 8 120014089 missense probably damaging 1.00
R3774:Crispld2 UTSW 8 120029266 missense probably damaging 0.99
R3776:Crispld2 UTSW 8 120029266 missense probably damaging 0.99
R6044:Crispld2 UTSW 8 120010671 missense possibly damaging 0.66
R6485:Crispld2 UTSW 8 120029309 missense probably damaging 0.99
R6861:Crispld2 UTSW 8 120026113 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTCACTCTTCAGACACTCAGTTTG -3'
(R):5'- CCAGTGTGCTCTGAGACAAAC -3'

Sequencing Primer
(F):5'- CAGACACTCAGTTTGTAAGATATGTC -3'
(R):5'- TGCTCTGAGACAAACGGAATTAAAGC -3'
Posted On2014-10-01