Incidental Mutation 'R0197:Chd1'
ID23517
Institutional Source Beutler Lab
Gene Symbol Chd1
Ensembl Gene ENSMUSG00000023852
Gene Namechromodomain helicase DNA binding protein 1
Synonyms4930525N21Rik
MMRRC Submission 038456-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0197 (G1)
Quality Score205
Status Validated
Chromosome17
Chromosomal Location15704967-15772610 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 15725431 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Lysine at position 72 (N72K)
Ref Sequence ENSEMBL: ENSMUSP00000134091 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000024627] [ENSMUST00000173311]
Predicted Effect probably benign
Transcript: ENSMUST00000024627
AA Change: N72K

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000024627
Gene: ENSMUSG00000023852
AA Change: N72K

DomainStartEndE-ValueType
low complexity region 17 67 N/A INTRINSIC
low complexity region 105 115 N/A INTRINSIC
low complexity region 116 136 N/A INTRINSIC
low complexity region 151 175 N/A INTRINSIC
low complexity region 213 230 N/A INTRINSIC
CHROMO 268 355 6.43e-20 SMART
CHROMO 385 443 1.19e-14 SMART
DEXDc 475 672 3.44e-34 SMART
Blast:DEXDc 692 786 2e-54 BLAST
low complexity region 787 799 N/A INTRINSIC
HELICc 816 900 8.48e-25 SMART
Blast:DEXDc 955 1234 1e-112 BLAST
PDB:4B4C|A 1119 1320 1e-132 PDB
low complexity region 1325 1348 N/A INTRINSIC
low complexity region 1377 1388 N/A INTRINSIC
DUF4208 1396 1500 5.54e-51 SMART
low complexity region 1507 1516 N/A INTRINSIC
low complexity region 1538 1549 N/A INTRINSIC
low complexity region 1626 1650 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173159
Predicted Effect probably benign
Transcript: ENSMUST00000173311
AA Change: N72K

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000134091
Gene: ENSMUSG00000023852
AA Change: N72K

DomainStartEndE-ValueType
low complexity region 17 67 N/A INTRINSIC
low complexity region 105 115 N/A INTRINSIC
low complexity region 116 136 N/A INTRINSIC
low complexity region 151 175 N/A INTRINSIC
low complexity region 213 230 N/A INTRINSIC
CHROMO 268 355 6.43e-20 SMART
CHROMO 385 443 1.19e-14 SMART
DEXDc 475 672 3.44e-34 SMART
Blast:DEXDc 692 786 2e-54 BLAST
low complexity region 787 799 N/A INTRINSIC
HELICc 816 900 8.48e-25 SMART
Blast:DEXDc 955 1078 2e-38 BLAST
Meta Mutation Damage Score 0.062 question?
Coding Region Coverage
  • 1x: 98.6%
  • 3x: 97.3%
  • 10x: 92.5%
  • 20x: 75.9%
Validation Efficiency 97% (121/125)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The CHD family of proteins is characterized by the presence of chromo (chromatin organization modifier) domains and SNF2-related helicase/ATPase domains. CHD genes alter gene expression possibly by modification of chromatin structure thus altering access of the transcriptional apparatus to its chromosomal DNA template. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit complete embryonic lethality associated with arrest of epiblast development due to increased apoptosis and cell cycle defects, abnormal rostral-caudal axis patterning, and failure to gastrulate. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110002E22Rik T C 3: 138,069,871 L1607P probably damaging Het
1700016H13Rik T C 5: 103,648,821 *118W probably null Het
1700061G19Rik A T 17: 56,883,835 N468Y probably benign Het
2610507B11Rik A C 11: 78,269,704 probably benign Het
4930452B06Rik C T 14: 8,518,695 G254R probably damaging Het
Abcc2 A T 19: 43,826,614 R1147* probably null Het
Agap2 A G 10: 127,091,702 T1131A possibly damaging Het
Aldh9a1 A G 1: 167,361,847 D388G probably damaging Het
Ap3d1 G T 10: 80,730,042 A97E probably damaging Het
Arhgef10 T A 8: 14,962,636 V320E probably damaging Het
Baiap2l1 C A 5: 144,266,010 V498L probably damaging Het
Ccdc189 T C 7: 127,584,862 E261G probably damaging Het
Cdh2 T C 18: 16,629,576 N437S probably benign Het
Col4a3bp T A 13: 96,549,287 Y63N probably benign Het
Cstf2t A T 19: 31,084,626 M521L probably benign Het
Dlx5 T C 6: 6,881,619 K90E possibly damaging Het
Dmp1 A G 5: 104,207,630 E32G possibly damaging Het
Espnl T G 1: 91,344,489 Y524D probably damaging Het
Fam20c T C 5: 138,755,724 L30P probably damaging Het
Fat1 G T 8: 45,026,553 A2879S probably benign Het
Gabrg1 A T 5: 70,774,389 V337D probably damaging Het
Gart C A 16: 91,623,403 D851Y possibly damaging Het
Gcc1 T C 6: 28,420,616 H234R probably damaging Het
Gemin6 T A 17: 80,228,095 H161Q probably damaging Het
Glt6d1 A G 2: 25,794,070 I308T probably benign Het
Gm10320 T C 13: 98,491,983 T7A probably benign Het
Gm10912 T C 2: 104,066,530 S5P probably benign Het
Gm13088 C T 4: 143,656,440 E70K possibly damaging Het
Gmpr2 T A 14: 55,672,735 D7E possibly damaging Het
Hc A G 2: 34,984,750 Y1620H probably damaging Het
Hoxa3 T C 6: 52,170,143 probably benign Het
Ift140 A G 17: 25,090,933 T1105A probably benign Het
Kdr G T 5: 75,968,422 T188N possibly damaging Het
Lepr A T 4: 101,752,152 D312V possibly damaging Het
Mcm3 A G 1: 20,810,105 V501A probably damaging Het
Mcur1 T C 13: 43,545,740 Y267C probably damaging Het
Med13 T A 11: 86,307,038 T736S probably benign Het
Med13l T C 5: 118,671,002 probably benign Het
Mroh2a G C 1: 88,246,042 A871P probably damaging Het
Ndrg2 T A 14: 51,907,003 probably benign Het
Oas3 G A 5: 120,756,145 R39C probably damaging Het
Olfr1258 A G 2: 89,930,201 T131A probably benign Het
Olfr1298 C T 2: 111,645,791 V69I probably benign Het
Olfr272 G A 4: 52,910,849 T315M probably benign Het
Olfr558 T A 7: 102,709,995 H245Q probably damaging Het
Onecut2 T A 18: 64,341,472 S365T possibly damaging Het
Pds5b C A 5: 150,754,431 Q505K probably benign Het
Rfx2 T C 17: 56,803,722 Y88C probably damaging Het
Rpl6 T C 5: 121,208,478 V214A probably benign Het
Samd3 T A 10: 26,271,854 C476S possibly damaging Het
Sfi1 TCGC TC 11: 3,146,254 probably null Het
Shank1 C T 7: 44,352,294 R1146W unknown Het
Smcr8 T C 11: 60,778,115 Y30H probably damaging Het
Smpd4 T A 16: 17,641,597 probably null Het
Strip1 C A 3: 107,614,613 D750Y probably damaging Het
Svep1 T C 4: 58,070,851 K2312E possibly damaging Het
Taf1c A T 8: 119,599,983 I438N probably damaging Het
Tnfaip1 A T 11: 78,530,014 probably benign Het
Unc45b T A 11: 82,940,205 L797Q possibly damaging Het
Usp24 T A 4: 106,407,133 W1754R probably damaging Het
Utp20 G A 10: 88,777,516 P1301L probably benign Het
Vmn2r115 T A 17: 23,359,781 S743T probably damaging Het
Vps41 T G 13: 18,854,663 probably null Het
Vps72 G T 3: 95,122,583 L304F probably damaging Het
Wiz A T 17: 32,356,441 I907N probably damaging Het
Zfp521 T C 18: 13,845,062 T765A probably benign Het
Zfp616 A T 11: 74,085,674 H923L probably damaging Het
Zp2 A T 7: 120,143,576 probably benign Het
Other mutations in Chd1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00704:Chd1 APN 17 15732565 missense probably benign 0.37
IGL01356:Chd1 APN 17 15749865 missense probably damaging 1.00
IGL01369:Chd1 APN 17 15754997 missense probably damaging 0.97
IGL01519:Chd1 APN 17 17378569 missense probably damaging 1.00
IGL01604:Chd1 APN 17 15770097 missense possibly damaging 0.95
IGL01635:Chd1 APN 17 17378596 missense probably damaging 1.00
IGL01721:Chd1 APN 17 15770168 missense probably damaging 1.00
IGL01959:Chd1 APN 17 15742173 missense probably damaging 1.00
IGL02367:Chd1 APN 17 17390053 missense probably damaging 0.98
IGL02476:Chd1 APN 17 15734273 missense probably damaging 1.00
IGL02756:Chd1 APN 17 15730807 missense probably damaging 0.97
IGL02817:Chd1 APN 17 15749500 missense possibly damaging 0.92
IGL03084:Chd1 APN 17 15770298 missense probably benign 0.22
IGL03108:Chd1 APN 17 15725281 missense possibly damaging 0.70
holly UTSW 17 15726283 missense possibly damaging 0.72
R0053:Chd1 UTSW 17 15747189 missense probably damaging 1.00
R0053:Chd1 UTSW 17 15747189 missense probably damaging 1.00
R0128:Chd1 UTSW 17 17393567 missense probably damaging 1.00
R0285:Chd1 UTSW 17 17374680 splice site probably benign
R0326:Chd1 UTSW 17 15768566 missense probably damaging 1.00
R0326:Chd1 UTSW 17 15768568 missense probably benign
R0372:Chd1 UTSW 17 17387290 missense probably benign 0.14
R0391:Chd1 UTSW 17 15749894 missense probably damaging 1.00
R0486:Chd1 UTSW 17 15734342 missense probably damaging 0.99
R0637:Chd1 UTSW 17 15742288 missense possibly damaging 0.50
R0675:Chd1 UTSW 17 15758261 unclassified probably benign
R0701:Chd1 UTSW 17 15725431 missense probably benign
R0788:Chd1 UTSW 17 15707114 missense possibly damaging 0.86
R0848:Chd1 UTSW 17 15770241 missense probably damaging 1.00
R0883:Chd1 UTSW 17 15725431 missense probably benign
R1169:Chd1 UTSW 17 15735732 missense probably damaging 1.00
R1218:Chd1 UTSW 17 15725312 missense probably damaging 1.00
R1370:Chd1 UTSW 17 17387480 missense probably benign 0.00
R1470:Chd1 UTSW 17 15726283 missense possibly damaging 0.72
R1470:Chd1 UTSW 17 15726283 missense possibly damaging 0.72
R1478:Chd1 UTSW 17 15739507 missense probably damaging 0.99
R1752:Chd1 UTSW 17 15743232 critical splice donor site probably null
R1759:Chd1 UTSW 17 17387271 missense probably benign 0.00
R1767:Chd1 UTSW 17 15770303 missense probably damaging 1.00
R1938:Chd1 UTSW 17 15762486 missense probably benign 0.39
R2007:Chd1 UTSW 17 15731006 missense probably damaging 1.00
R2069:Chd1 UTSW 17 15742294 missense probably damaging 1.00
R3771:Chd1 UTSW 17 17374651 missense probably damaging 1.00
R3773:Chd1 UTSW 17 17374651 missense probably damaging 1.00
R3849:Chd1 UTSW 17 15731871 missense probably damaging 1.00
R4241:Chd1 UTSW 17 15770027 nonsense probably null
R4242:Chd1 UTSW 17 15770027 nonsense probably null
R4354:Chd1 UTSW 17 17390001 missense probably benign 0.23
R4468:Chd1 UTSW 17 15760395 missense probably damaging 0.99
R4469:Chd1 UTSW 17 15760395 missense probably damaging 0.99
R4731:Chd1 UTSW 17 17377817 missense probably benign 0.36
R4824:Chd1 UTSW 17 15733124 missense probably damaging 1.00
R4840:Chd1 UTSW 17 15768753 nonsense probably null
R4840:Chd1 UTSW 17 15768754 missense probably damaging 1.00
R4880:Chd1 UTSW 17 17374654 missense probably damaging 1.00
R4960:Chd1 UTSW 17 15742231 missense probably damaging 0.96
R5071:Chd1 UTSW 17 15762405 missense probably benign
R5078:Chd1 UTSW 17 15726354 missense possibly damaging 0.93
R5114:Chd1 UTSW 17 15728198 missense probably benign 0.25
R5268:Chd1 UTSW 17 15735743 missense probably damaging 1.00
R5304:Chd1 UTSW 17 15754951 missense probably benign 0.01
R5304:Chd1 UTSW 17 15770268 missense possibly damaging 0.55
R5307:Chd1 UTSW 17 15732570 missense probably damaging 1.00
R5458:Chd1 UTSW 17 15738549 missense probably damaging 1.00
R5553:Chd1 UTSW 17 17385613 missense probably benign 0.17
R5623:Chd1 UTSW 17 15754932 missense probably damaging 1.00
R6022:Chd1 UTSW 17 17377773 missense probably benign 0.39
R6137:Chd1 UTSW 17 15758688 missense probably damaging 1.00
R6257:Chd1 UTSW 17 15730203 intron probably null
R6373:Chd1 UTSW 17 15738636 missense probably damaging 1.00
R6458:Chd1 UTSW 17 15730602 missense probably benign 0.01
R6476:Chd1 UTSW 17 17380988 critical splice donor site probably null
R6508:Chd1 UTSW 17 15738633 missense probably benign 0.31
R6553:Chd1 UTSW 17 15725430 missense probably benign 0.00
R6745:Chd1 UTSW 17 17387167 missense probably benign 0.08
Predicted Primers PCR Primer
(F):5'- TGATTGTGGGTCAGCATCAGGC -3'
(R):5'- CCTTGGGCAGATAGACAGACAAGC -3'

Sequencing Primer
(F):5'- GCTCTGACTCAGGAAGTCAATCA -3'
(R):5'- CAACCACTTGGTGCTTGTG -3'
Posted On2013-04-16