Incidental Mutation 'R2161:Arel1'
ID235171
Institutional Source Beutler Lab
Gene Symbol Arel1
Ensembl Gene ENSMUSG00000042350
Gene Nameapoptosis resistant E3 ubiquitin protein ligase 1
Synonyms1110018G07Rik
MMRRC Submission 040164-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.403) question?
Stock #R2161 (G1)
Quality Score225
Status Not validated
Chromosome12
Chromosomal Location84918148-84970900 bp(-) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) A to G at 84921256 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000048780 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000043169] [ENSMUST00000163231]
Predicted Effect probably null
Transcript: ENSMUST00000043169
SMART Domains Protein: ENSMUSP00000048780
Gene: ENSMUSG00000042350

DomainStartEndE-ValueType
transmembrane domain 2 19 N/A INTRINSIC
IG_FLMN 56 160 4.53e-2 SMART
low complexity region 346 360 N/A INTRINSIC
Blast:HECTc 401 474 6e-39 BLAST
HECTc 481 823 1.04e-158 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000116345
Predicted Effect probably benign
Transcript: ENSMUST00000163231
SMART Domains Protein: ENSMUSP00000129213
Gene: ENSMUSG00000042350

DomainStartEndE-ValueType
transmembrane domain 2 19 N/A INTRINSIC
IG_FLMN 56 160 4.53e-2 SMART
low complexity region 346 360 N/A INTRINSIC
Blast:HECTc 386 474 1e-51 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000163802
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
6430573F11Rik T C 8: 36,505,650 C85R probably damaging Het
Adamts12 A G 15: 11,215,735 M281V probably damaging Het
Ap1g1 A T 8: 109,844,354 D423V probably damaging Het
Arhgap33 T C 7: 30,528,650 probably null Het
Arhgef18 T G 8: 3,439,575 Y302* probably null Het
Blm T C 7: 80,481,370 probably null Het
Cep295 T G 9: 15,353,058 E97D probably damaging Het
Cep295nl T C 11: 118,332,509 D503G possibly damaging Het
Chchd2 G T 5: 129,884,148 A29E probably damaging Het
Cic A G 7: 25,288,134 probably null Het
Cmtr1 C T 17: 29,702,173 L798F probably benign Het
Col11a2 C A 17: 34,064,797 probably benign Het
Crispld2 A G 8: 120,015,339 Y142C probably damaging Het
Csmd3 CCTTTGCGCTT CCTT 15: 47,741,236 probably null Het
Dsp G A 13: 38,196,451 D1792N probably damaging Het
Esp4 C A 17: 40,602,393 N50K probably benign Het
Fbxo21 T C 5: 117,995,386 S404P probably damaging Het
Ggnbp2 A G 11: 84,834,433 F639L probably benign Het
Golph3l G A 3: 95,617,125 G229D probably damaging Het
Hlx G T 1: 184,727,641 S433R probably benign Het
Kdm2b T A 5: 122,880,699 S233C probably damaging Het
Krt14 C T 11: 100,207,113 G115R unknown Het
Ldb3 A G 14: 34,567,396 probably null Het
Lrp1 T A 10: 127,555,738 E2937D probably damaging Het
Mark2 G C 19: 7,282,747 S111C probably damaging Het
Naa20 T A 2: 145,911,795 probably null Het
Ndufa8 A T 2: 36,036,515 W170R probably damaging Het
Nlrp2 A T 7: 5,325,042 L671I probably damaging Het
Olfr1462 T A 19: 13,191,309 I214K probably damaging Het
Olfr603 T A 7: 103,383,200 R267S probably benign Het
Ptgir A G 7: 16,906,869 M29V possibly damaging Het
Ptpro A G 6: 137,449,887 D280G probably benign Het
Reps1 A G 10: 18,096,283 E361G probably damaging Het
Rgs6 A G 12: 83,091,804 E304G probably damaging Het
Siglece T C 7: 43,659,369 T187A probably benign Het
Slc5a10 C T 11: 61,719,934 G5R probably null Het
Sohlh1 A G 2: 25,844,636 I215T probably benign Het
Stag1 T A 9: 100,889,595 V691D probably damaging Het
Tectb C G 19: 55,180,999 probably benign Het
Tmed8 A G 12: 87,174,257 V185A probably damaging Het
Trim71 A G 9: 114,512,772 F814S probably damaging Het
Tsnax A T 8: 125,015,689 K52N probably damaging Het
Tubgcp3 T C 8: 12,632,292 T676A probably benign Het
Other mutations in Arel1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00928:Arel1 APN 12 84934162 missense probably damaging 0.98
IGL01532:Arel1 APN 12 84934162 missense possibly damaging 0.46
IGL01640:Arel1 APN 12 84920701 missense probably damaging 1.00
IGL02522:Arel1 APN 12 84927910 missense probably damaging 1.00
IGL02675:Arel1 APN 12 84930228 missense probably damaging 1.00
IGL02867:Arel1 APN 12 84934323 missense probably benign 0.01
IGL03231:Arel1 APN 12 84934310 missense probably benign
R0244:Arel1 UTSW 12 84920693 missense probably damaging 0.99
R0363:Arel1 UTSW 12 84934253 missense probably damaging 1.00
R0538:Arel1 UTSW 12 84941837 missense probably damaging 1.00
R1633:Arel1 UTSW 12 84926283 missense probably damaging 1.00
R1965:Arel1 UTSW 12 84940399 critical splice acceptor site probably null
R4691:Arel1 UTSW 12 84930249 splice site probably null
R4958:Arel1 UTSW 12 84926304 missense possibly damaging 0.89
R4999:Arel1 UTSW 12 84931767 missense probably damaging 0.99
R5088:Arel1 UTSW 12 84924115 missense probably damaging 1.00
R5154:Arel1 UTSW 12 84931773 missense probably benign
R5939:Arel1 UTSW 12 84926292 missense probably damaging 0.99
R5945:Arel1 UTSW 12 84926347 missense probably benign 0.20
R6118:Arel1 UTSW 12 84941939 missense possibly damaging 0.46
R6421:Arel1 UTSW 12 84934345 missense probably damaging 1.00
R6458:Arel1 UTSW 12 84940385 missense possibly damaging 0.87
X0066:Arel1 UTSW 12 84934382 missense probably damaging 0.99
X0066:Arel1 UTSW 12 84943329 splice site probably null
Predicted Primers PCR Primer
(F):5'- CAATTGATTGCTTGGCTCTGC -3'
(R):5'- TGGCATTGGTTTCATTCTGCATAC -3'

Sequencing Primer
(F):5'- AGTGGTAGTCAAGGCACCTGTC -3'
(R):5'- CATACCCATGTATGTAGGTAACTGAC -3'
Posted On2014-10-01