Incidental Mutation 'R2162:Eng'
ID235187
Institutional Source Beutler Lab
Gene Symbol Eng
Ensembl Gene ENSMUSG00000026814
Gene Nameendoglin
SynonymsCD105, Endo
MMRRC Submission 040165-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R2162 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location32646595-32682669 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 32679047 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Cysteine at position 528 (R528C)
Ref Sequence ENSEMBL: ENSMUSP00000130585 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000009705] [ENSMUST00000028148] [ENSMUST00000113272] [ENSMUST00000167841]
Predicted Effect probably damaging
Transcript: ENSMUST00000009705
AA Change: R529C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000009705
Gene: ENSMUSG00000026814
AA Change: R529C

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
low complexity region 336 346 N/A INTRINSIC
ZP 362 569 1.29e-2 SMART
transmembrane domain 587 609 N/A INTRINSIC
low complexity region 619 634 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000028148
SMART Domains Protein: ENSMUSP00000028148
Gene: ENSMUSG00000009566

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
SCOP:d1jbwa2 43 327 1e-59 SMART
PDB:1O5Z|A 99 389 2e-37 PDB
Predicted Effect probably damaging
Transcript: ENSMUST00000113272
AA Change: R529C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000108897
Gene: ENSMUSG00000026814
AA Change: R529C

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
low complexity region 335 345 N/A INTRINSIC
ZP 361 568 1.29e-2 SMART
transmembrane domain 586 608 N/A INTRINSIC
low complexity region 618 633 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130164
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132327
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142186
Predicted Effect unknown
Transcript: ENSMUST00000156306
AA Change: R242C
SMART Domains Protein: ENSMUSP00000122186
Gene: ENSMUSG00000026814
AA Change: R242C

DomainStartEndE-ValueType
low complexity region 26 36 N/A INTRINSIC
ZP 52 283 1.23e-3 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000167841
AA Change: R528C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000130585
Gene: ENSMUSG00000026814
AA Change: R528C

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
low complexity region 336 346 N/A INTRINSIC
ZP 362 569 1.29e-2 SMART
transmembrane domain 587 609 N/A INTRINSIC
low complexity region 616 625 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000175536
Predicted Effect noncoding transcript
Transcript: ENSMUST00000196848
Meta Mutation Damage Score 0.176 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.6%
Validation Efficiency 100% (55/55)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a homodimeric transmembrane protein which is a major glycoprotein of the vascular endothelium. This protein is a component of the transforming growth factor beta receptor complex and it binds to the beta1 and beta3 peptides with high affinity. Mutations in this gene cause hereditary hemorrhagic telangiectasia, also known as Osler-Rendu-Weber syndrome 1, an autosomal dominant multisystemic vascular dysplasia. This gene may also be involved in preeclampsia and several types of cancer. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, May 2013]
PHENOTYPE: Homozygotes for targeted null mutations show defective vascular development, extra-arterial hematopoiesis, cardiac defects and die by embryonic day 11.0. Heterozygotes develop hemorrhagic telangiectasia causing strokes, fatal hemorrhage and heart failure. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700022I11Rik A G 4: 42,972,238 T524A possibly damaging Het
Adamts20 A C 15: 94,331,458 C927G probably damaging Het
Afdn T A 17: 13,896,174 D190E probably benign Het
Ankrd28 T C 14: 31,708,762 D850G probably damaging Het
Arhgap45 T C 10: 80,016,979 M1T probably null Het
Atp6v0a4 T G 6: 38,088,646 K128N possibly damaging Het
Bcat1 T A 6: 145,010,108 D349V probably damaging Het
Cacna1i T C 15: 80,356,187 F370S probably damaging Het
Clca4b T C 3: 144,928,587 I82V probably benign Het
Csmd3 CCTTTGCGCTT CCTT 15: 47,741,236 probably null Het
Cyfip2 T C 11: 46,261,506 D485G probably benign Het
Cyp27b1 G T 10: 127,051,060 V382L probably damaging Het
Dnaaf5 T C 5: 139,181,565 V447A possibly damaging Het
Dpp9 A T 17: 56,199,113 F429I possibly damaging Het
Gcn1l1 A T 5: 115,592,132 Q835L probably benign Het
Gprc6a CAAA CA 10: 51,615,680 probably null Het
Hlx T A 1: 184,730,692 probably null Het
Htt T A 5: 34,821,718 V815D probably benign Het
Il1f5 G T 2: 24,279,680 L17F probably damaging Het
Itga1 C T 13: 115,030,910 V157I probably benign Het
Krtap19-3 T G 16: 88,877,719 *88C probably null Het
Lzic G C 4: 149,488,728 E112D probably null Het
Mark2 G C 19: 7,282,747 S111C probably damaging Het
Mep1b C T 18: 21,086,239 T150I possibly damaging Het
Mroh7 G C 4: 106,700,181 S777R probably damaging Het
Nrxn1 G A 17: 90,162,431 R35C probably damaging Het
Olfr1145 T A 2: 87,810,360 I180K probably damaging Het
Olfr494 C A 7: 108,367,562 P24Q probably benign Het
Olfr624 T G 7: 103,670,872 Q53P possibly damaging Het
Pacs2 A G 12: 113,050,947 T243A probably benign Het
Pan2 A G 10: 128,304,222 E4G possibly damaging Het
Pdp1 A G 4: 11,961,123 V396A probably damaging Het
Pdzd7 A G 19: 45,036,055 probably null Het
Peg10 T A 6: 4,755,914 probably benign Het
Pgc C A 17: 47,729,311 F93L probably null Het
Piezo2 A G 18: 63,081,662 probably null Het
Pja2 T C 17: 64,309,402 D166G probably benign Het
Ppp1r9b T C 11: 94,998,051 L97P probably damaging Het
Ptgir A G 7: 16,906,869 M29V possibly damaging Het
S100a10 T C 3: 93,564,373 V88A probably damaging Het
Scn9a T A 2: 66,534,229 Y789F probably damaging Het
Slit3 A T 11: 35,688,682 S1229C probably null Het
Sptan1 T C 2: 30,018,576 probably benign Het
Srrd G T 5: 112,342,944 probably benign Het
Tdrd3 A G 14: 87,480,785 T201A probably damaging Het
Tectb C G 19: 55,180,999 probably benign Het
Ttll4 A G 1: 74,686,391 K653E probably damaging Het
Usp43 A G 11: 67,879,969 L613P probably damaging Het
Vmn1r167 T C 7: 23,504,799 D264G possibly damaging Het
Whamm A G 7: 81,571,341 D7G probably damaging Het
Zcchc17 T C 4: 130,338,524 D62G probably benign Het
Zfp280d T A 9: 72,298,822 I62K probably damaging Het
Zfp445 T G 9: 122,852,476 E800A probably damaging Het
Zfp516 A G 18: 82,986,938 R656G possibly damaging Het
Other mutations in Eng
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01326:Eng APN 2 32672382 missense probably benign 0.03
IGL01432:Eng APN 2 32669532 missense possibly damaging 0.66
IGL02203:Eng APN 2 32671486 missense probably benign 0.35
IGL02330:Eng APN 2 32669569 splice site probably null
IGL02633:Eng APN 2 32673274 missense probably damaging 0.99
IGL02747:Eng APN 2 32672958 critical splice donor site probably null
R0008:Eng UTSW 2 32677680 missense probably damaging 0.97
R0149:Eng UTSW 2 32672385 critical splice donor site probably null
R0206:Eng UTSW 2 32678993 missense probably benign 0.15
R0208:Eng UTSW 2 32678993 missense probably benign 0.15
R0360:Eng UTSW 2 32679137 missense probably benign 0.27
R0364:Eng UTSW 2 32679137 missense probably benign 0.27
R1399:Eng UTSW 2 32673322 missense probably damaging 0.98
R1520:Eng UTSW 2 32672941 missense probably benign 0.41
R1752:Eng UTSW 2 32673392 missense probably benign
R2201:Eng UTSW 2 32673740 splice site probably benign
R2389:Eng UTSW 2 32657672 critical splice donor site probably null
R3021:Eng UTSW 2 32678568 missense probably damaging 1.00
R3428:Eng UTSW 2 32657533 missense probably damaging 0.97
R4704:Eng UTSW 2 32678912 missense probably benign 0.00
R5024:Eng UTSW 2 32673392 missense probably benign 0.00
R5130:Eng UTSW 2 32681506 missense probably damaging 1.00
R5182:Eng UTSW 2 32672959 critical splice donor site probably null
R6270:Eng UTSW 2 32673643 missense probably benign 0.26
R6790:Eng UTSW 2 32669445 missense probably damaging 0.99
R6872:Eng UTSW 2 32673275 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCTAACTGACGTCAAGAGGGC -3'
(R):5'- AAACGTGTAGGTGGATAGTTGC -3'

Sequencing Primer
(F):5'- AGCCAAGGATACCTGCGTGTATC -3'
(R):5'- CAGGTGTGTGTATATACTGACATCAC -3'
Posted On2014-10-01