Incidental Mutation 'R2162:Mark2'
ID235241
Institutional Source Beutler Lab
Gene Symbol Mark2
Ensembl Gene ENSMUSG00000024969
Gene NameMAP/microtubule affinity regulating kinase 2
SynonymsEmk, Par-1
MMRRC Submission 040165-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.768) question?
Stock #R2162 (G1)
Quality Score225
Status Validated
Chromosome19
Chromosomal Location7275396-7341860 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to C at 7282747 bp
ZygosityHeterozygous
Amino Acid Change Serine to Cysteine at position 111 (S111C)
Ref Sequence ENSEMBL: ENSMUSP00000129490 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025921] [ENSMUST00000032557] [ENSMUST00000051711] [ENSMUST00000164129] [ENSMUST00000164205] [ENSMUST00000165286] [ENSMUST00000165965] [ENSMUST00000166461] [ENSMUST00000167767] [ENSMUST00000168872] [ENSMUST00000169541] [ENSMUST00000171352] [ENSMUST00000171393]
Predicted Effect probably benign
Transcript: ENSMUST00000025921
AA Change: S462C

PolyPhen 2 Score 0.109 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000025921
Gene: ENSMUSG00000024969
AA Change: S462C

DomainStartEndE-ValueType
S_TKc 20 271 1.59e-108 SMART
UBA 292 329 7.69e-7 SMART
low complexity region 475 489 N/A INTRINSIC
low complexity region 532 545 N/A INTRINSIC
Pfam:KA1 697 743 2.5e-21 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000032557
AA Change: S495C

PolyPhen 2 Score 0.012 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000032557
Gene: ENSMUSG00000024969
AA Change: S495C

DomainStartEndE-ValueType
S_TKc 53 304 1.59e-108 SMART
UBA 325 362 7.69e-7 SMART
low complexity region 511 524 N/A INTRINSIC
Pfam:KA1 685 731 5.4e-22 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000051711
AA Change: S495C

PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000108969
Gene: ENSMUSG00000024969
AA Change: S495C

DomainStartEndE-ValueType
S_TKc 53 304 1.59e-108 SMART
UBA 325 362 7.69e-7 SMART
low complexity region 508 522 N/A INTRINSIC
low complexity region 565 578 N/A INTRINSIC
Pfam:KA1 730 776 6.6e-22 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000163345
SMART Domains Protein: ENSMUSP00000125944
Gene: ENSMUSG00000024969

DomainStartEndE-ValueType
low complexity region 3 15 N/A INTRINSIC
low complexity region 58 71 N/A INTRINSIC
Predicted Effect silent
Transcript: ENSMUST00000164129
Predicted Effect probably damaging
Transcript: ENSMUST00000164205
AA Change: S495C

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000127827
Gene: ENSMUSG00000024969
AA Change: S495C

DomainStartEndE-ValueType
S_TKc 53 304 1.59e-108 SMART
UBA 325 362 7.69e-7 SMART
low complexity region 511 524 N/A INTRINSIC
Pfam:KA1 676 722 5.4e-22 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000165286
AA Change: S495C

PolyPhen 2 Score 0.840 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000126468
Gene: ENSMUSG00000024969
AA Change: S495C

DomainStartEndE-ValueType
S_TKc 53 304 1.59e-108 SMART
UBA 325 362 7.69e-7 SMART
low complexity region 511 524 N/A INTRINSIC
Pfam:KA1 670 716 6e-22 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000165881
AA Change: S74C
SMART Domains Protein: ENSMUSP00000126753
Gene: ENSMUSG00000024969
AA Change: S74C

DomainStartEndE-ValueType
low complexity region 88 102 N/A INTRINSIC
low complexity region 145 158 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000165965
AA Change: S495C

PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000131684
Gene: ENSMUSG00000024969
AA Change: S495C

DomainStartEndE-ValueType
S_TKc 53 304 1.59e-108 SMART
UBA 325 362 7.69e-7 SMART
low complexity region 508 522 N/A INTRINSIC
low complexity region 565 578 N/A INTRINSIC
Pfam:KA1 732 776 7.2e-24 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000166461
AA Change: S32C

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000128549
Gene: ENSMUSG00000024969
AA Change: S32C

DomainStartEndE-ValueType
low complexity region 45 59 N/A INTRINSIC
low complexity region 102 115 N/A INTRINSIC
Pfam:KA1 261 307 1.9e-22 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000167767
AA Change: S37C

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000132482
Gene: ENSMUSG00000024969
AA Change: S37C

DomainStartEndE-ValueType
low complexity region 53 66 N/A INTRINSIC
PDB:3OSE|A 220 264 1e-18 PDB
Predicted Effect noncoding transcript
Transcript: ENSMUST00000168852
Predicted Effect probably damaging
Transcript: ENSMUST00000168872
AA Change: S495C

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000128560
Gene: ENSMUSG00000024969
AA Change: S495C

DomainStartEndE-ValueType
S_TKc 53 304 1.59e-108 SMART
UBA 325 362 7.69e-7 SMART
low complexity region 511 524 N/A INTRINSIC
Pfam:KA1 661 707 5.9e-22 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000169541
SMART Domains Protein: ENSMUSP00000128779
Gene: ENSMUSG00000024969

DomainStartEndE-ValueType
Pfam:Pkinase 53 110 1.7e-12 PFAM
Pfam:Pkinase_Tyr 53 110 7.2e-8 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000170768
Predicted Effect noncoding transcript
Transcript: ENSMUST00000171044
Predicted Effect probably damaging
Transcript: ENSMUST00000171352
AA Change: S111C

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000129490
Gene: ENSMUSG00000024969
AA Change: S111C

DomainStartEndE-ValueType
low complexity region 127 140 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000171393
SMART Domains Protein: ENSMUSP00000129894
Gene: ENSMUSG00000024969

DomainStartEndE-ValueType
Pfam:Pkinase 20 193 1.2e-59 PFAM
Pfam:Pkinase_Tyr 20 193 1.2e-35 PFAM
Pfam:RIO1 30 174 3e-7 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000171721
AA Change: S485C
SMART Domains Protein: ENSMUSP00000129506
Gene: ENSMUSG00000024969
AA Change: S485C

DomainStartEndE-ValueType
S_TKc 44 295 1.59e-108 SMART
UBA 316 353 7.69e-7 SMART
low complexity region 499 513 N/A INTRINSIC
low complexity region 556 569 N/A INTRINSIC
Pfam:KA1 732 776 7.2e-24 PFAM
Meta Mutation Damage Score 0.332 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.6%
Validation Efficiency 100% (55/55)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the Par-1 family of serine/threonine protein kinases. The protein is an important regulator of cell polarity in epithelial and neuronal cells, and also controls the stability of microtubules through phosphorylation and inactivation of several microtubule-associating proteins. The protein localizes to cell membranes. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2009]
PHENOTYPE: Homozygotes for targeted null mutations exhibit proportionate dwarfism with smaller pituitaries and reduced growth hormone and prolactin secretion. Mutants develop autoimmunity and fail to breed when mated to each other. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700022I11Rik A G 4: 42,972,238 T524A possibly damaging Het
Adamts20 A C 15: 94,331,458 C927G probably damaging Het
Afdn T A 17: 13,896,174 D190E probably benign Het
Ankrd28 T C 14: 31,708,762 D850G probably damaging Het
Arhgap45 T C 10: 80,016,979 M1T probably null Het
Atp6v0a4 T G 6: 38,088,646 K128N possibly damaging Het
Bcat1 T A 6: 145,010,108 D349V probably damaging Het
Cacna1i T C 15: 80,356,187 F370S probably damaging Het
Clca4b T C 3: 144,928,587 I82V probably benign Het
Csmd3 CCTTTGCGCTT CCTT 15: 47,741,236 probably null Het
Cyfip2 T C 11: 46,261,506 D485G probably benign Het
Cyp27b1 G T 10: 127,051,060 V382L probably damaging Het
Dnaaf5 T C 5: 139,181,565 V447A possibly damaging Het
Dpp9 A T 17: 56,199,113 F429I possibly damaging Het
Eng C T 2: 32,679,047 R528C probably damaging Het
Gcn1l1 A T 5: 115,592,132 Q835L probably benign Het
Gprc6a CAAA CA 10: 51,615,680 probably null Het
Hlx T A 1: 184,730,692 probably null Het
Htt T A 5: 34,821,718 V815D probably benign Het
Il1f5 G T 2: 24,279,680 L17F probably damaging Het
Itga1 C T 13: 115,030,910 V157I probably benign Het
Krtap19-3 T G 16: 88,877,719 *88C probably null Het
Lzic G C 4: 149,488,728 E112D probably null Het
Mep1b C T 18: 21,086,239 T150I possibly damaging Het
Mroh7 G C 4: 106,700,181 S777R probably damaging Het
Nrxn1 G A 17: 90,162,431 R35C probably damaging Het
Olfr1145 T A 2: 87,810,360 I180K probably damaging Het
Olfr494 C A 7: 108,367,562 P24Q probably benign Het
Olfr624 T G 7: 103,670,872 Q53P possibly damaging Het
Pacs2 A G 12: 113,050,947 T243A probably benign Het
Pan2 A G 10: 128,304,222 E4G possibly damaging Het
Pdp1 A G 4: 11,961,123 V396A probably damaging Het
Pdzd7 A G 19: 45,036,055 probably null Het
Peg10 T A 6: 4,755,914 probably benign Het
Pgc C A 17: 47,729,311 F93L probably null Het
Piezo2 A G 18: 63,081,662 probably null Het
Pja2 T C 17: 64,309,402 D166G probably benign Het
Ppp1r9b T C 11: 94,998,051 L97P probably damaging Het
Ptgir A G 7: 16,906,869 M29V possibly damaging Het
S100a10 T C 3: 93,564,373 V88A probably damaging Het
Scn9a T A 2: 66,534,229 Y789F probably damaging Het
Slit3 A T 11: 35,688,682 S1229C probably null Het
Sptan1 T C 2: 30,018,576 probably benign Het
Srrd G T 5: 112,342,944 probably benign Het
Tdrd3 A G 14: 87,480,785 T201A probably damaging Het
Tectb C G 19: 55,180,999 probably benign Het
Ttll4 A G 1: 74,686,391 K653E probably damaging Het
Usp43 A G 11: 67,879,969 L613P probably damaging Het
Vmn1r167 T C 7: 23,504,799 D264G possibly damaging Het
Whamm A G 7: 81,571,341 D7G probably damaging Het
Zcchc17 T C 4: 130,338,524 D62G probably benign Het
Zfp280d T A 9: 72,298,822 I62K probably damaging Het
Zfp445 T G 9: 122,852,476 E800A probably damaging Het
Zfp516 A G 18: 82,986,938 R656G possibly damaging Het
Other mutations in Mark2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00567:Mark2 APN 19 7341184 missense possibly damaging 0.53
IGL01522:Mark2 APN 19 7281238 missense probably benign 0.06
IGL02368:Mark2 APN 19 7284490 missense probably damaging 1.00
IGL02836:Mark2 APN 19 7278040 critical splice donor site probably null
IGL03233:Mark2 APN 19 7284726 missense possibly damaging 0.89
R0015:Mark2 UTSW 19 7285777 nonsense probably null
R0025:Mark2 UTSW 19 7285922 missense probably damaging 1.00
R0025:Mark2 UTSW 19 7285922 missense probably damaging 1.00
R0035:Mark2 UTSW 19 7284652 splice site probably benign
R0035:Mark2 UTSW 19 7284652 splice site probably benign
R0047:Mark2 UTSW 19 7283577 splice site probably benign
R0047:Mark2 UTSW 19 7283577 splice site probably benign
R0335:Mark2 UTSW 19 7281828 missense probably benign 0.27
R0627:Mark2 UTSW 19 7281960 critical splice acceptor site probably null
R0734:Mark2 UTSW 19 7285981 splice site probably benign
R0744:Mark2 UTSW 19 7285824 missense probably damaging 1.00
R0836:Mark2 UTSW 19 7285824 missense probably damaging 1.00
R1099:Mark2 UTSW 19 7277425 missense probably benign 0.41
R1861:Mark2 UTSW 19 7290763 missense possibly damaging 0.73
R1873:Mark2 UTSW 19 7284515 missense probably damaging 1.00
R2160:Mark2 UTSW 19 7282747 missense probably damaging 1.00
R2161:Mark2 UTSW 19 7282747 missense probably damaging 1.00
R2308:Mark2 UTSW 19 7281934 missense probably damaging 1.00
R2844:Mark2 UTSW 19 7286862 missense probably damaging 1.00
R2845:Mark2 UTSW 19 7286862 missense probably damaging 1.00
R2846:Mark2 UTSW 19 7286862 missense probably damaging 1.00
R2902:Mark2 UTSW 19 7283448 missense probably benign 0.00
R2935:Mark2 UTSW 19 7285889 missense probably benign 0.09
R3853:Mark2 UTSW 19 7277290 missense probably damaging 1.00
R4377:Mark2 UTSW 19 7290689 missense possibly damaging 0.66
R4522:Mark2 UTSW 19 7285948 missense probably damaging 1.00
R4737:Mark2 UTSW 19 7281232 missense probably damaging 0.96
R5103:Mark2 UTSW 19 7284503 missense probably damaging 1.00
R5154:Mark2 UTSW 19 7283074 missense probably damaging 0.99
R5579:Mark2 UTSW 19 7282816 missense probably damaging 1.00
R6163:Mark2 UTSW 19 7290761 missense probably benign 0.00
R6186:Mark2 UTSW 19 7283202 missense probably benign 0.01
R6387:Mark2 UTSW 19 7285902 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACTGGTACCCTATGCTTGGC -3'
(R):5'- GAGCTTACTGTAGAAAGTGGGC -3'

Sequencing Primer
(F):5'- CTATGCTTGGCAACGTCAAG -3'
(R):5'- TGAGACAGTACTTGCCCT -3'
Posted On2014-10-01