Incidental Mutation 'R2163:Eif5b'
ID235245
Institutional Source Beutler Lab
Gene Symbol Eif5b
Ensembl Gene ENSMUSG00000026083
Gene Nameeukaryotic translation initiation factor 5B
SynonymsA030003E17Rik, IF2
MMRRC Submission 040166-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R2163 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location37998010-38055579 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 38048794 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Valine at position 957 (D957V)
Ref Sequence ENSEMBL: ENSMUSP00000027252 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027251] [ENSMUST00000027252]
Predicted Effect probably benign
Transcript: ENSMUST00000027251
SMART Domains Protein: ENSMUSP00000027251
Gene: ENSMUSG00000026082

DomainStartEndE-ValueType
BRCT 46 121 3.99e-13 SMART
low complexity region 320 342 N/A INTRINSIC
Pfam:IMS 420 620 1.9e-43 PFAM
Pfam:IMS_C 700 831 5.8e-20 PFAM
low complexity region 888 901 N/A INTRINSIC
Pfam:DUF4414 938 1071 9.7e-11 PFAM
Pfam:REV1_C 1127 1248 1.2e-43 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000027252
AA Change: D957V

PolyPhen 2 Score 0.317 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000027252
Gene: ENSMUSG00000026083
AA Change: D957V

DomainStartEndE-ValueType
low complexity region 19 32 N/A INTRINSIC
low complexity region 33 51 N/A INTRINSIC
low complexity region 94 106 N/A INTRINSIC
low complexity region 110 126 N/A INTRINSIC
low complexity region 145 161 N/A INTRINSIC
low complexity region 183 193 N/A INTRINSIC
coiled coil region 227 272 N/A INTRINSIC
coiled coil region 301 414 N/A INTRINSIC
low complexity region 480 498 N/A INTRINSIC
coiled coil region 523 554 N/A INTRINSIC
low complexity region 580 594 N/A INTRINSIC
Pfam:GTP_EFTU 625 840 4.7e-35 PFAM
Pfam:MMR_HSR1 629 753 5.1e-6 PFAM
Pfam:GTP_EFTU_D2 866 944 7.1e-11 PFAM
Pfam:IF-2 959 1066 1.4e-20 PFAM
Blast:S1 1116 1172 2e-6 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000192548
Predicted Effect noncoding transcript
Transcript: ENSMUST00000193008
Predicted Effect noncoding transcript
Transcript: ENSMUST00000193151
Predicted Effect noncoding transcript
Transcript: ENSMUST00000193806
Predicted Effect noncoding transcript
Transcript: ENSMUST00000194650
Predicted Effect noncoding transcript
Transcript: ENSMUST00000195664
Meta Mutation Damage Score 0.228 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.6%
  • 20x: 95.9%
Validation Efficiency 97% (76/78)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Accurate initiation of translation in eukaryotes is complex and requires many factors, some of which are composed of multiple subunits. The process is simpler in prokaryotes which have only three initiation factors (IF1, IF2, IF3). Two of these factors are conserved in eukaryotes: the homolog of IF1 is eIF1A and the homolog of IF2 is eIF5B. This gene encodes eIF5B. Factors eIF1A and eIF5B interact on the ribosome along with other initiation factors and GTP to position the initiation methionine tRNA on the start codon of the mRNA so that translation initiates accurately. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610010F05Rik T C 11: 23,576,826 probably benign Het
2410089E03Rik T A 15: 8,203,251 probably null Het
4930578I07Rik C A 14: 66,938,548 T64K unknown Het
Ablim2 T C 5: 35,802,353 probably benign Het
Acp4 T C 7: 44,255,976 D107G probably damaging Het
Adamts2 T A 11: 50,788,805 C871S probably benign Het
Adamts3 A G 5: 89,708,718 V332A probably damaging Het
Alkal1 C T 1: 6,389,512 T104M probably benign Het
Astn1 A G 1: 158,502,150 S192G probably damaging Het
Axdnd1 A C 1: 156,392,003 V337G probably damaging Het
Baiap2l2 T C 15: 79,259,195 D481G possibly damaging Het
Cacna2d1 C T 5: 16,362,319 T964I probably damaging Het
Carf T C 1: 60,147,486 probably benign Het
Catsper2 T C 2: 121,400,175 D295G probably damaging Het
Cdh1 A G 8: 106,649,081 T84A probably benign Het
Chd8 T A 14: 52,198,818 H2508L possibly damaging Het
Chl1 A T 6: 103,711,231 T284S probably damaging Het
Chtop A T 3: 90,502,211 M125K probably benign Het
Col14a1 T A 15: 55,444,645 probably benign Het
Cyp2b10 A T 7: 25,925,385 probably benign Het
Cyp2c70 G A 19: 40,160,719 H328Y possibly damaging Het
Dcbld1 A G 10: 52,286,356 T77A probably damaging Het
Dnah6 A T 6: 73,089,746 probably null Het
Efhd1 A T 1: 87,289,473 D104V probably damaging Het
Eps15 T A 4: 109,370,669 S549R probably damaging Het
Fbxo3 C A 2: 104,054,985 H400N probably benign Het
Fcer1a A G 1: 173,222,697 V86A probably damaging Het
Fh1 A G 1: 175,614,840 M148T possibly damaging Het
Foxc1 C A 13: 31,808,603 H466N unknown Het
Gadl1 T A 9: 115,949,558 I180N possibly damaging Het
Gm10801 G C 2: 98,664,007 R143T possibly damaging Het
Gm21718 T C 14: 51,317,766 noncoding transcript Het
Gm6614 G A 6: 141,980,938 T554I possibly damaging Het
Hivep2 T A 10: 14,128,226 Y189* probably null Het
Hoxd13 T A 2: 74,669,069 S254T possibly damaging Het
Hspd1 A G 1: 55,078,538 probably benign Het
Il1r1 A G 1: 40,294,863 M198V probably benign Het
Katnal1 T A 5: 148,888,936 I362F probably damaging Het
Muc2 CGTG CGTGTG 7: 141,699,185 probably null Het
Mybpc1 T C 10: 88,540,942 probably benign Het
Mycbp2 A G 14: 103,169,855 probably null Het
Nell2 G T 15: 95,429,978 N301K probably damaging Het
Nenf T A 1: 191,309,935 D108V probably damaging Het
Nfkbiz T C 16: 55,818,218 N293S probably benign Het
Nipbl T C 15: 8,336,919 K1229E probably damaging Het
Nlrp4a T C 7: 26,453,397 F631L probably benign Het
Nrp1 T A 8: 128,497,871 V705E probably damaging Het
Nsf G C 11: 103,863,333 A459G possibly damaging Het
Olfr1128 A G 2: 87,544,894 S217P probably damaging Het
Olfr366 A G 2: 37,220,077 E196G probably damaging Het
Pdia4 C T 6: 47,798,407 D490N possibly damaging Het
Pinlyp T A 7: 24,541,801 Y192F probably benign Het
Pkd2 T C 5: 104,455,677 probably benign Het
Ppara A G 15: 85,801,046 K399E probably benign Het
Ppp4r2 C A 6: 100,865,086 N169K probably damaging Het
Prom1 T A 5: 44,014,163 E632V possibly damaging Het
Rpap3 T A 15: 97,680,348 Y562F possibly damaging Het
Rsph14 T A 10: 74,957,779 K263N probably damaging Het
Scn11a T G 9: 119,755,025 D1508A probably damaging Het
Scn7a T C 2: 66,675,956 T1530A probably damaging Het
Sec14l1 T A 11: 117,143,282 probably null Het
Slc4a4 A G 5: 89,214,576 I840V probably damaging Het
Slco1c1 T A 6: 141,559,752 V419D probably benign Het
Sltm T A 9: 70,591,682 F1013I probably damaging Het
Spam1 A G 6: 24,796,847 K266E probably benign Het
Syt15 A G 14: 34,226,116 E306G probably benign Het
Tap1 A T 17: 34,189,473 probably null Het
Tbc1d16 G C 11: 119,155,078 probably benign Het
Tex47 T C 5: 7,305,022 Y68H probably damaging Het
Ttn A T 2: 76,811,243 L5176Q possibly damaging Het
Ttn T C 2: 76,812,501 T13264A probably damaging Het
Ubxn2a A T 12: 4,885,757 F131Y probably damaging Het
Usp40 T C 1: 87,995,858 probably benign Het
Vmn1r170 T C 7: 23,607,037 L288P probably damaging Het
Vmn1r175 A G 7: 23,808,927 Y92H probably benign Het
Wdpcp G T 11: 21,885,015 E673* probably null Het
Zfr T A 15: 12,162,223 L820I probably damaging Het
Other mutations in Eif5b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00334:Eif5b APN 1 38041719 missense probably damaging 1.00
IGL01377:Eif5b APN 1 38036098 missense probably benign
IGL01395:Eif5b APN 1 38037258 missense probably damaging 0.96
IGL01572:Eif5b APN 1 38022254 nonsense probably null
IGL01615:Eif5b APN 1 38045706 missense probably damaging 1.00
IGL02141:Eif5b APN 1 38032322 missense probably benign 0.09
IGL02260:Eif5b APN 1 38045456 missense possibly damaging 0.81
IGL02308:Eif5b APN 1 38041747 missense probably damaging 1.00
IGL03180:Eif5b APN 1 38036269 missense probably damaging 1.00
IGL03327:Eif5b APN 1 38041691 splice site probably benign
R0018:Eif5b UTSW 1 38018889 missense unknown
R0036:Eif5b UTSW 1 38019111 missense probably benign 0.23
R0137:Eif5b UTSW 1 38019243 missense probably benign 0.23
R0349:Eif5b UTSW 1 38032366 missense probably benign 0.18
R0606:Eif5b UTSW 1 38048893 missense probably damaging 1.00
R1056:Eif5b UTSW 1 38022167 missense unknown
R1225:Eif5b UTSW 1 38037628 missense probably damaging 1.00
R2043:Eif5b UTSW 1 38041819 missense probably damaging 1.00
R2225:Eif5b UTSW 1 38019223 missense unknown
R2432:Eif5b UTSW 1 38019342 missense unknown
R2922:Eif5b UTSW 1 38018019 splice site probably benign
R4357:Eif5b UTSW 1 38050258 missense probably damaging 1.00
R4631:Eif5b UTSW 1 38041747 missense probably damaging 1.00
R4665:Eif5b UTSW 1 38045712 missense probably damaging 1.00
R4702:Eif5b UTSW 1 38018877 missense unknown
R4941:Eif5b UTSW 1 38051199 missense probably damaging 1.00
R4995:Eif5b UTSW 1 38051711 makesense probably null
R5020:Eif5b UTSW 1 38019069 nonsense probably null
R5175:Eif5b UTSW 1 38045387 missense probably damaging 1.00
R5375:Eif5b UTSW 1 38045754 missense possibly damaging 0.66
R5566:Eif5b UTSW 1 38045684 missense possibly damaging 0.90
R5566:Eif5b UTSW 1 38051247 missense probably damaging 1.00
R5853:Eif5b UTSW 1 38037307 missense probably damaging 1.00
R5978:Eif5b UTSW 1 37998280 unclassified probably null
R6315:Eif5b UTSW 1 38018033 missense unknown
R6376:Eif5b UTSW 1 38045679 missense probably damaging 0.98
R6388:Eif5b UTSW 1 38019000 missense unknown
R6444:Eif5b UTSW 1 38036211 missense probably damaging 1.00
R6455:Eif5b UTSW 1 38019027 missense probably benign 0.23
R6810:Eif5b UTSW 1 38046660 missense probably benign 0.45
R6877:Eif5b UTSW 1 38050239 missense probably damaging 1.00
R7130:Eif5b UTSW 1 38041776 missense probably damaging 1.00
R7180:Eif5b UTSW 1 38049074 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- CTAAGTGCTGCAGAGATTTAGTC -3'
(R):5'- TCCAGGTTTAGCATGCATCAGG -3'

Sequencing Primer
(F):5'- TGCTGCAGAGATTTAGTCTATTTTC -3'
(R):5'- CAGGTTTAGCATGCATCAGGTAATTG -3'
Posted On2014-10-01