Incidental Mutation 'R2163:Il1r1'
ID235246
Institutional Source Beutler Lab
Gene Symbol Il1r1
Ensembl Gene ENSMUSG00000026072
Gene Nameinterleukin 1 receptor, type I
SynonymsIL-1R1, IL-iR, CD121a, IL-1 receptor alpha chain, Il1r-1
MMRRC Submission 040166-MU
Accession Numbers

Genbank: NM_008362, NM_001123382

Is this an essential gene? Probably non essential (E-score: 0.074) question?
Stock #R2163 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location40225080-40317257 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 40294863 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Valine at position 198 (M198V)
Ref Sequence ENSEMBL: ENSMUSP00000110443 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027241] [ENSMUST00000114795]
Predicted Effect probably benign
Transcript: ENSMUST00000027241
AA Change: M201V

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000027241
Gene: ENSMUSG00000026072
AA Change: M201V

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
IG 38 117 2.94e-1 SMART
IG_like 132 218 5.56e0 SMART
IG 236 333 1.35e0 SMART
Blast:TIR 347 381 1e-7 BLAST
TIR 387 544 1.93e-29 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000114795
AA Change: M198V

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000110443
Gene: ENSMUSG00000026072
AA Change: M198V

DomainStartEndE-ValueType
signal peptide 1 16 N/A INTRINSIC
IG 35 114 2.94e-1 SMART
IG_like 129 215 5.56e0 SMART
IG 233 330 1.35e0 SMART
Blast:TIR 344 378 1e-7 BLAST
TIR 384 541 1.93e-29 SMART
Meta Mutation Damage Score 0.19 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.6%
  • 20x: 95.9%
Validation Efficiency 97% (76/78)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a cytokine receptor that belongs to the interleukin-1 receptor family. The encoded protein is a receptor for interleukin-1 alpha, interleukin-1 beta, and interleukin-1 receptor antagonist. It is an important mediator involved in many cytokine-induced immune and inflammatory responses. This gene is located in a cluster of related cytokine receptor genes on chromosome 2q12. [provided by RefSeq, Dec 2013]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit increased susceptibility to bacterial infection, reduced IL1b responsiveness, delayed tooth eruption, decreased susceptibility to experimental autoimmune uveoritinitis, decreased susceptibility to kidney reperfusion injury, and late onset obesity. [provided by MGI curators]
Allele List at MGI

All alleles(3) : Targeted, knock-out(2) Gene trapped(1)

Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610010F05Rik T C 11: 23,576,826 probably benign Het
2410089E03Rik T A 15: 8,203,251 probably null Het
4930578I07Rik C A 14: 66,938,548 T64K unknown Het
Ablim2 T C 5: 35,802,353 probably benign Het
Acp4 T C 7: 44,255,976 D107G probably damaging Het
Adamts2 T A 11: 50,788,805 C871S probably benign Het
Adamts3 A G 5: 89,708,718 V332A probably damaging Het
Alkal1 C T 1: 6,389,512 T104M probably benign Het
Astn1 A G 1: 158,502,150 S192G probably damaging Het
Axdnd1 A C 1: 156,392,003 V337G probably damaging Het
Baiap2l2 T C 15: 79,259,195 D481G possibly damaging Het
Cacna2d1 C T 5: 16,362,319 T964I probably damaging Het
Carf T C 1: 60,147,486 probably benign Het
Catsper2 T C 2: 121,400,175 D295G probably damaging Het
Cdh1 A G 8: 106,649,081 T84A probably benign Het
Chd8 T A 14: 52,198,818 H2508L possibly damaging Het
Chl1 A T 6: 103,711,231 T284S probably damaging Het
Chtop A T 3: 90,502,211 M125K probably benign Het
Col14a1 T A 15: 55,444,645 probably benign Het
Cyp2b10 A T 7: 25,925,385 probably benign Het
Cyp2c70 G A 19: 40,160,719 H328Y possibly damaging Het
Dcbld1 A G 10: 52,286,356 T77A probably damaging Het
Dnah6 A T 6: 73,089,746 probably null Het
Efhd1 A T 1: 87,289,473 D104V probably damaging Het
Eif5b A T 1: 38,048,794 D957V probably benign Het
Eps15 T A 4: 109,370,669 S549R probably damaging Het
Fbxo3 C A 2: 104,054,985 H400N probably benign Het
Fcer1a A G 1: 173,222,697 V86A probably damaging Het
Fh1 A G 1: 175,614,840 M148T possibly damaging Het
Foxc1 C A 13: 31,808,603 H466N unknown Het
Gadl1 T A 9: 115,949,558 I180N possibly damaging Het
Gm10801 G C 2: 98,664,007 R143T possibly damaging Het
Gm21718 T C 14: 51,317,766 noncoding transcript Het
Gm6614 G A 6: 141,980,938 T554I possibly damaging Het
Hivep2 T A 10: 14,128,226 Y189* probably null Het
Hoxd13 T A 2: 74,669,069 S254T possibly damaging Het
Hspd1 A G 1: 55,078,538 probably benign Het
Katnal1 T A 5: 148,888,936 I362F probably damaging Het
Muc2 CGTG CGTGTG 7: 141,699,185 probably null Het
Mybpc1 T C 10: 88,540,942 probably benign Het
Mycbp2 A G 14: 103,169,855 probably null Het
Nell2 G T 15: 95,429,978 N301K probably damaging Het
Nenf T A 1: 191,309,935 D108V probably damaging Het
Nfkbiz T C 16: 55,818,218 N293S probably benign Het
Nipbl T C 15: 8,336,919 K1229E probably damaging Het
Nlrp4a T C 7: 26,453,397 F631L probably benign Het
Nrp1 T A 8: 128,497,871 V705E probably damaging Het
Nsf G C 11: 103,863,333 A459G possibly damaging Het
Olfr1128 A G 2: 87,544,894 S217P probably damaging Het
Olfr366 A G 2: 37,220,077 E196G probably damaging Het
Pdia4 C T 6: 47,798,407 D490N possibly damaging Het
Pinlyp T A 7: 24,541,801 Y192F probably benign Het
Pkd2 T C 5: 104,455,677 probably benign Het
Ppara A G 15: 85,801,046 K399E probably benign Het
Ppp4r2 C A 6: 100,865,086 N169K probably damaging Het
Prom1 T A 5: 44,014,163 E632V possibly damaging Het
Rpap3 T A 15: 97,680,348 Y562F possibly damaging Het
Rsph14 T A 10: 74,957,779 K263N probably damaging Het
Scn11a T G 9: 119,755,025 D1508A probably damaging Het
Scn7a T C 2: 66,675,956 T1530A probably damaging Het
Sec14l1 T A 11: 117,143,282 probably null Het
Slc4a4 A G 5: 89,214,576 I840V probably damaging Het
Slco1c1 T A 6: 141,559,752 V419D probably benign Het
Sltm T A 9: 70,591,682 F1013I probably damaging Het
Spam1 A G 6: 24,796,847 K266E probably benign Het
Syt15 A G 14: 34,226,116 E306G probably benign Het
Tap1 A T 17: 34,189,473 probably null Het
Tbc1d16 G C 11: 119,155,078 probably benign Het
Tex47 T C 5: 7,305,022 Y68H probably damaging Het
Ttn A T 2: 76,811,243 L5176Q possibly damaging Het
Ttn T C 2: 76,812,501 T13264A probably damaging Het
Ubxn2a A T 12: 4,885,757 F131Y probably damaging Het
Usp40 T C 1: 87,995,858 probably benign Het
Vmn1r170 T C 7: 23,607,037 L288P probably damaging Het
Vmn1r175 A G 7: 23,808,927 Y92H probably benign Het
Wdpcp G T 11: 21,885,015 E673* probably null Het
Zfr T A 15: 12,162,223 L820I probably damaging Het
Other mutations in Il1r1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01457:Il1r1 APN 1 40313170 missense probably damaging 1.00
IGL01532:Il1r1 APN 1 40294928 critical splice donor site probably null
IGL01610:Il1r1 APN 1 40302400 missense probably benign 0.09
IGL01668:Il1r1 APN 1 40313329 missense probably benign 0.31
IGL01729:Il1r1 APN 1 40294826 missense probably damaging 1.00
IGL02201:Il1r1 APN 1 40313268 missense probably damaging 0.97
IGL02229:Il1r1 APN 1 40313358 missense probably damaging 0.99
IGL02428:Il1r1 APN 1 40313232 missense possibly damaging 0.74
IGL02902:Il1r1 APN 1 40302409 missense probably benign 0.09
G5030:Il1r1 UTSW 1 40313163 missense possibly damaging 0.80
R0604:Il1r1 UTSW 1 40282246 missense probably benign 0.36
R1515:Il1r1 UTSW 1 40293349 nonsense probably null
R1530:Il1r1 UTSW 1 40312361 missense probably benign 0.00
R1727:Il1r1 UTSW 1 40293264 missense probably benign 0.16
R1957:Il1r1 UTSW 1 40313140 nonsense probably null
R2313:Il1r1 UTSW 1 40313310 missense probably benign 0.19
R4345:Il1r1 UTSW 1 40297924 missense probably benign 0.00
R4622:Il1r1 UTSW 1 40312420 missense probably damaging 0.96
R4735:Il1r1 UTSW 1 40293295 missense probably benign 0.00
R5033:Il1r1 UTSW 1 40293524 missense probably damaging 1.00
R5586:Il1r1 UTSW 1 40225251 start gained probably benign
R6375:Il1r1 UTSW 1 40294890 missense probably damaging 1.00
R6383:Il1r1 UTSW 1 40313335 missense possibly damaging 0.58
R6618:Il1r1 UTSW 1 40300811 missense probably damaging 0.97
R7169:Il1r1 UTSW 1 40293359 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- GAGCTCCTAACTGTCCCATG -3'
(R):5'- GTCATTGACCAGTTCCTAGACTTAG -3'

Sequencing Primer
(F):5'- TTAGAACTGTAAACCATTCCACTGC -3'
(R):5'- GTTCCTTTTTAGACAACAGAGCAATG -3'
Posted On2014-10-01