Incidental Mutation 'R2163:Scn7a'
ID235256
Institutional Source Beutler Lab
Gene Symbol Scn7a
Ensembl Gene ENSMUSG00000034810
Gene Namesodium channel, voltage-gated, type VII, alpha
SynonymsNaG, Nav2, Nav2.3, Nax, Scn6a
MMRRC Submission 040166-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.271) question?
Stock #R2163 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location66673425-66784914 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 66675956 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 1530 (T1530A)
Ref Sequence ENSEMBL: ENSMUSP00000042405 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042792]
Predicted Effect probably damaging
Transcript: ENSMUST00000042792
AA Change: T1530A

PolyPhen 2 Score 0.967 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000042405
Gene: ENSMUSG00000034810
AA Change: T1530A

DomainStartEndE-ValueType
Pfam:Ion_trans 118 405 4.7e-53 PFAM
coiled coil region 415 443 N/A INTRINSIC
Pfam:Ion_trans 505 739 5.8e-36 PFAM
Pfam:Na_trans_assoc 741 929 4.1e-17 PFAM
Pfam:Ion_trans 933 1204 3e-49 PFAM
Pfam:Ion_trans 1250 1505 5e-37 PFAM
IQ 1624 1646 6.4e-2 SMART
Meta Mutation Damage Score 0.178 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.6%
  • 20x: 95.9%
Validation Efficiency 97% (76/78)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes one of the many voltage-gated sodium channel proteins. For proper functioning of neurons and muscles during action potentials, voltage-gated sodium channels direct sodium ion diffusion for membrane depolarization. This sodium channel protein has some atypical characteristics; the similarity between the human and mouse proteins is lower compared to other orthologous sodium channel pairs. Also, the S4 segments, which sense voltage changes, have fewer positive charged residues that in other sodium channels; domain 4 has fewer arginine and lysine residues compared to other sodium channel proteins. Several alternatively spliced transcript variants exist, but the full-length natures of all of them remain unknown. [provided by RefSeq, Dec 2011]
PHENOTYPE: Mice homozygous for disruptions in this gene have a modified dietary preference for NaCl but are phenotypically normal otherwise. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610010F05Rik T C 11: 23,576,826 probably benign Het
2410089E03Rik T A 15: 8,203,251 probably null Het
4930578I07Rik C A 14: 66,938,548 T64K unknown Het
Ablim2 T C 5: 35,802,353 probably benign Het
Acp4 T C 7: 44,255,976 D107G probably damaging Het
Adamts2 T A 11: 50,788,805 C871S probably benign Het
Adamts3 A G 5: 89,708,718 V332A probably damaging Het
Alkal1 C T 1: 6,389,512 T104M probably benign Het
Astn1 A G 1: 158,502,150 S192G probably damaging Het
Axdnd1 A C 1: 156,392,003 V337G probably damaging Het
Baiap2l2 T C 15: 79,259,195 D481G possibly damaging Het
Cacna2d1 C T 5: 16,362,319 T964I probably damaging Het
Carf T C 1: 60,147,486 probably benign Het
Catsper2 T C 2: 121,400,175 D295G probably damaging Het
Cdh1 A G 8: 106,649,081 T84A probably benign Het
Chd8 T A 14: 52,198,818 H2508L possibly damaging Het
Chl1 A T 6: 103,711,231 T284S probably damaging Het
Chtop A T 3: 90,502,211 M125K probably benign Het
Col14a1 T A 15: 55,444,645 probably benign Het
Cyp2b10 A T 7: 25,925,385 probably benign Het
Cyp2c70 G A 19: 40,160,719 H328Y possibly damaging Het
Dcbld1 A G 10: 52,286,356 T77A probably damaging Het
Dnah6 A T 6: 73,089,746 probably null Het
Efhd1 A T 1: 87,289,473 D104V probably damaging Het
Eif5b A T 1: 38,048,794 D957V probably benign Het
Eps15 T A 4: 109,370,669 S549R probably damaging Het
Fbxo3 C A 2: 104,054,985 H400N probably benign Het
Fcer1a A G 1: 173,222,697 V86A probably damaging Het
Fh1 A G 1: 175,614,840 M148T possibly damaging Het
Foxc1 C A 13: 31,808,603 H466N unknown Het
Gadl1 T A 9: 115,949,558 I180N possibly damaging Het
Gm10801 G C 2: 98,664,007 R143T possibly damaging Het
Gm21718 T C 14: 51,317,766 noncoding transcript Het
Gm6614 G A 6: 141,980,938 T554I possibly damaging Het
Hivep2 T A 10: 14,128,226 Y189* probably null Het
Hoxd13 T A 2: 74,669,069 S254T possibly damaging Het
Hspd1 A G 1: 55,078,538 probably benign Het
Il1r1 A G 1: 40,294,863 M198V probably benign Het
Katnal1 T A 5: 148,888,936 I362F probably damaging Het
Muc2 CGTG CGTGTG 7: 141,699,185 probably null Het
Mybpc1 T C 10: 88,540,942 probably benign Het
Mycbp2 A G 14: 103,169,855 probably null Het
Nell2 G T 15: 95,429,978 N301K probably damaging Het
Nenf T A 1: 191,309,935 D108V probably damaging Het
Nfkbiz T C 16: 55,818,218 N293S probably benign Het
Nipbl T C 15: 8,336,919 K1229E probably damaging Het
Nlrp4a T C 7: 26,453,397 F631L probably benign Het
Nrp1 T A 8: 128,497,871 V705E probably damaging Het
Nsf G C 11: 103,863,333 A459G possibly damaging Het
Olfr1128 A G 2: 87,544,894 S217P probably damaging Het
Olfr366 A G 2: 37,220,077 E196G probably damaging Het
Pdia4 C T 6: 47,798,407 D490N possibly damaging Het
Pinlyp T A 7: 24,541,801 Y192F probably benign Het
Pkd2 T C 5: 104,455,677 probably benign Het
Ppara A G 15: 85,801,046 K399E probably benign Het
Ppp4r2 C A 6: 100,865,086 N169K probably damaging Het
Prom1 T A 5: 44,014,163 E632V possibly damaging Het
Rpap3 T A 15: 97,680,348 Y562F possibly damaging Het
Rsph14 T A 10: 74,957,779 K263N probably damaging Het
Scn11a T G 9: 119,755,025 D1508A probably damaging Het
Sec14l1 T A 11: 117,143,282 probably null Het
Slc4a4 A G 5: 89,214,576 I840V probably damaging Het
Slco1c1 T A 6: 141,559,752 V419D probably benign Het
Sltm T A 9: 70,591,682 F1013I probably damaging Het
Spam1 A G 6: 24,796,847 K266E probably benign Het
Syt15 A G 14: 34,226,116 E306G probably benign Het
Tap1 A T 17: 34,189,473 probably null Het
Tbc1d16 G C 11: 119,155,078 probably benign Het
Tex47 T C 5: 7,305,022 Y68H probably damaging Het
Ttn A T 2: 76,811,243 L5176Q possibly damaging Het
Ttn T C 2: 76,812,501 T13264A probably damaging Het
Ubxn2a A T 12: 4,885,757 F131Y probably damaging Het
Usp40 T C 1: 87,995,858 probably benign Het
Vmn1r170 T C 7: 23,607,037 L288P probably damaging Het
Vmn1r175 A G 7: 23,808,927 Y92H probably benign Het
Wdpcp G T 11: 21,885,015 E673* probably null Het
Zfr T A 15: 12,162,223 L820I probably damaging Het
Other mutations in Scn7a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00090:Scn7a APN 2 66683327 splice site probably benign
IGL00432:Scn7a APN 2 66741982 nonsense probably null
IGL00720:Scn7a APN 2 66676044 missense possibly damaging 0.67
IGL00783:Scn7a APN 2 66692564 missense probably damaging 0.99
IGL00784:Scn7a APN 2 66692564 missense probably damaging 0.99
IGL00926:Scn7a APN 2 66684131 missense probably benign 0.06
IGL00963:Scn7a APN 2 66703945 splice site probably benign
IGL01099:Scn7a APN 2 66684238 missense probably damaging 1.00
IGL01326:Scn7a APN 2 66752260 missense probably benign 0.13
IGL01538:Scn7a APN 2 66703852 missense probably benign
IGL01624:Scn7a APN 2 66751925 missense probably benign 0.07
IGL01794:Scn7a APN 2 66675509 missense probably benign
IGL02100:Scn7a APN 2 66675499 makesense probably null
IGL02326:Scn7a APN 2 66700048 missense probably benign 0.00
IGL02472:Scn7a APN 2 66752314 missense probably damaging 1.00
IGL02528:Scn7a APN 2 66700175 missense probably damaging 1.00
IGL02798:Scn7a APN 2 66713875 missense probably benign 0.00
IGL03026:Scn7a APN 2 66676098 missense probably damaging 0.99
IGL03071:Scn7a APN 2 66699947 missense possibly damaging 0.89
IGL03080:Scn7a APN 2 66697816 missense probably benign 0.01
IGL03180:Scn7a APN 2 66676234 missense possibly damaging 0.94
IGL03337:Scn7a APN 2 66675960 missense probably benign 0.00
PIT4514001:Scn7a UTSW 2 66684179 missense probably damaging 1.00
R0004:Scn7a UTSW 2 66687795 missense possibly damaging 0.81
R0076:Scn7a UTSW 2 66714037 missense probably benign 0.04
R0230:Scn7a UTSW 2 66726284 missense probably damaging 1.00
R0463:Scn7a UTSW 2 66675740 missense probably benign 0.05
R0846:Scn7a UTSW 2 66697600 missense possibly damaging 0.71
R1237:Scn7a UTSW 2 66680295 missense probably damaging 0.98
R1282:Scn7a UTSW 2 66700849 missense probably damaging 0.98
R1467:Scn7a UTSW 2 66689558 missense probably benign 0.01
R1467:Scn7a UTSW 2 66689558 missense probably benign 0.01
R1501:Scn7a UTSW 2 66700163 missense probably benign 0.37
R1672:Scn7a UTSW 2 66697600 missense possibly damaging 0.71
R1690:Scn7a UTSW 2 66675943 missense probably damaging 0.99
R1712:Scn7a UTSW 2 66705103 missense probably benign 0.05
R1758:Scn7a UTSW 2 66680183 missense probably benign 0.00
R1758:Scn7a UTSW 2 66700887 missense probably damaging 0.97
R1775:Scn7a UTSW 2 66680955 missense probably benign 0.02
R1848:Scn7a UTSW 2 66684013 critical splice donor site probably null
R1851:Scn7a UTSW 2 66680291 missense probably benign
R1919:Scn7a UTSW 2 66699973 missense probably damaging 1.00
R1932:Scn7a UTSW 2 66676102 missense probably damaging 1.00
R1945:Scn7a UTSW 2 66675980 missense probably damaging 1.00
R1970:Scn7a UTSW 2 66684289 missense possibly damaging 0.89
R1998:Scn7a UTSW 2 66683269 missense probably damaging 0.99
R2008:Scn7a UTSW 2 66687747 missense possibly damaging 0.82
R2038:Scn7a UTSW 2 66737436 missense probably damaging 1.00
R2113:Scn7a UTSW 2 66675968 missense probably damaging 1.00
R2128:Scn7a UTSW 2 66697986 missense probably damaging 0.99
R2421:Scn7a UTSW 2 66726302 splice site probably benign
R2446:Scn7a UTSW 2 66692658 missense probably damaging 0.98
R2922:Scn7a UTSW 2 66700207 splice site probably benign
R3015:Scn7a UTSW 2 66699896 missense probably benign 0.08
R3034:Scn7a UTSW 2 66682808 missense probably damaging 1.00
R3419:Scn7a UTSW 2 66700895 frame shift probably null
R3429:Scn7a UTSW 2 66700895 frame shift probably null
R3430:Scn7a UTSW 2 66700895 frame shift probably null
R3434:Scn7a UTSW 2 66675503 missense probably benign 0.01
R3803:Scn7a UTSW 2 66680246 nonsense probably null
R3831:Scn7a UTSW 2 66697684 missense probably damaging 0.96
R3833:Scn7a UTSW 2 66697684 missense probably damaging 0.96
R4017:Scn7a UTSW 2 66741985 missense probably damaging 1.00
R4244:Scn7a UTSW 2 66742001 missense probably benign 0.00
R4245:Scn7a UTSW 2 66742001 missense probably benign 0.00
R4276:Scn7a UTSW 2 66684063 missense probably damaging 0.97
R4307:Scn7a UTSW 2 66675755 missense possibly damaging 0.47
R4327:Scn7a UTSW 2 66737471 missense probably damaging 1.00
R4353:Scn7a UTSW 2 66676436 missense probably benign 0.00
R4721:Scn7a UTSW 2 66684185 missense probably damaging 1.00
R4722:Scn7a UTSW 2 66700884 missense possibly damaging 0.95
R4781:Scn7a UTSW 2 66703760 missense possibly damaging 0.95
R4792:Scn7a UTSW 2 66726248 missense probably damaging 1.00
R5362:Scn7a UTSW 2 66699998 missense probably damaging 1.00
R5437:Scn7a UTSW 2 66676346 missense probably damaging 1.00
R5729:Scn7a UTSW 2 66741957 critical splice donor site probably null
R5777:Scn7a UTSW 2 66692569 missense probably damaging 1.00
R5785:Scn7a UTSW 2 66697568 missense possibly damaging 0.79
R5821:Scn7a UTSW 2 66743703 missense probably damaging 0.96
R5830:Scn7a UTSW 2 66714051 nonsense probably null
R5877:Scn7a UTSW 2 66699873 nonsense probably null
R5881:Scn7a UTSW 2 66675526 missense probably benign 0.01
R5967:Scn7a UTSW 2 66675713 missense probably damaging 1.00
R5988:Scn7a UTSW 2 66726214 nonsense probably null
R6077:Scn7a UTSW 2 66697596 missense probably damaging 1.00
R6135:Scn7a UTSW 2 66703900 missense probably benign
R6242:Scn7a UTSW 2 66700766 missense probably benign 0.00
R6264:Scn7a UTSW 2 66675526 missense possibly damaging 0.93
R6291:Scn7a UTSW 2 66700114 missense probably damaging 0.98
R6544:Scn7a UTSW 2 66684100 missense probably damaging 1.00
R6770:Scn7a UTSW 2 66729184 intron probably null
R6997:Scn7a UTSW 2 66703803 missense probably damaging 1.00
R7014:Scn7a UTSW 2 66741959 missense probably null 1.00
R7126:Scn7a UTSW 2 66757286 missense possibly damaging 0.80
R7129:Scn7a UTSW 2 66700193 missense probably benign 0.14
R7176:Scn7a UTSW 2 66676288 missense probably damaging 1.00
R7185:Scn7a UTSW 2 66687795 missense possibly damaging 0.81
R7276:Scn7a UTSW 2 66757162 missense probably damaging 1.00
X0060:Scn7a UTSW 2 66689682 missense probably benign 0.01
X0066:Scn7a UTSW 2 66680192 missense probably benign
Z1088:Scn7a UTSW 2 66713951 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- ACATGAACCCGGATTCTATCTC -3'
(R):5'- AGATTGTGGGAGCCCTTCTG -3'

Sequencing Primer
(F):5'- GAACCCGGATTCTATCTCTGAAAGG -3'
(R):5'- GAGCCCTTCTGTTGGGATTTC -3'
Posted On2014-10-01