Mutagenetix > Incidental Mutation

Incidental Mutation 'R2163:Hoxd13'

235257

Institutional Source

Beutler Lab

Gene Symbol

Hoxd13

Ensembl Gene

ENSMUSG00000001819

Gene Name

homeobox D13

Synonyms

spdh, Hox-4.8

MMRRC Submission

040166-MU

Accession Numbers

Essential gene?

Possibly essential (E-score: 0.630) question?

Stock #

R2163 (G1)

Quality Score

204

Status

Validated

Chromosome

Chromosomal Location

74498654-74501943 bp(+) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 74499413 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Serine to Threonine at position 254 (S254T)

Ref Sequence

ENSEMBL: ENSMUSP00000001872 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000001872]

AlphaFold

P70217

Predicted Effect

possibly damaging
Transcript: ENSMUST00000001872
AA Change: S254T

PolyPhen 2 Score 0.823 (Sensitivity: 0.84; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000001872
Gene: ENSMUSG00000001819
AA Change: S254T

Domain	Start	End	E-Value	Type
low complexity region	14	34	N/A	INTRINSIC
Pfam:HoxA13_N	75	177	4e-18	PFAM
HOX	272	334	4.33e-22	SMART

Meta Mutation Damage Score

0.5706

Coding Region Coverage

1x: 99.3%
3x: 98.7%
10x: 97.6%
20x: 95.9%

Validation Efficiency

97% (76/78)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene belongs to the homeobox family of genes. The homeobox genes encode a highly conserved family of transcription factors that play an important role in morphogenesis in all multicellular organisms. Mammals possess four similar homeobox gene clusters, HOXA, HOXB, HOXC and HOXD, located on different chromosomes, consisting of 9 to 11 genes arranged in tandem. This gene is one of several homeobox HOXD genes located in a cluster on chromosome 2. Deletions that remove the entire HOXD gene cluster or the 5' end of this cluster have been associated with severe limb and genital abnormalities. Mutations in this particular gene cause synpolydactyly. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for targeted and spontaneous mutations exhibit abnormalities of the axial skeleton, especially limbs, and of the male accessory organs, and agenesis of the preputial glands. Mutant males are sterile. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 77 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930578I07Rik	C	A	14: 67,175,997 (GRCm39)	T64K	unknown	Het
Ablim2	T	C	5: 35,959,697 (GRCm39)		probably benign	Het
Acp4	T	C	7: 43,905,400 (GRCm39)	D107G	probably damaging	Het
Adamts2	T	A	11: 50,679,632 (GRCm39)	C871S	probably benign	Het
Adamts3	A	G	5: 89,856,577 (GRCm39)	V332A	probably damaging	Het
Alkal1	C	T	1: 6,459,736 (GRCm39)	T104M	probably benign	Het
Astn1	A	G	1: 158,329,720 (GRCm39)	S192G	probably damaging	Het
Axdnd1	A	C	1: 156,219,573 (GRCm39)	V337G	probably damaging	Het
Baiap2l2	T	C	15: 79,143,395 (GRCm39)	D481G	possibly damaging	Het
Cacna2d1	C	T	5: 16,567,317 (GRCm39)	T964I	probably damaging	Het
Carf	T	C	1: 60,186,645 (GRCm39)		probably benign	Het
Catsper2	T	C	2: 121,230,656 (GRCm39)	D295G	probably damaging	Het
Cdh1	A	G	8: 107,375,713 (GRCm39)	T84A	probably benign	Het
Chd8	T	A	14: 52,436,275 (GRCm39)	H2508L	possibly damaging	Het
Chl1	A	T	6: 103,688,192 (GRCm39)	T284S	probably damaging	Het
Chtop	A	T	3: 90,409,518 (GRCm39)	M125K	probably benign	Het
Col14a1	T	A	15: 55,308,041 (GRCm39)		probably benign	Het
Cplane1	T	A	15: 8,232,735 (GRCm39)		probably null	Het
Cyp2b10	A	T	7: 25,624,810 (GRCm39)		probably benign	Het
Cyp2c70	G	A	19: 40,149,163 (GRCm39)	H328Y	possibly damaging	Het
Dcbld1	A	G	10: 52,162,452 (GRCm39)	T77A	probably damaging	Het
Dnah6	A	T	6: 73,066,729 (GRCm39)		probably null	Het
Efhd1	A	T	1: 87,217,195 (GRCm39)	D104V	probably damaging	Het
Eif5b	A	T	1: 38,087,875 (GRCm39)	D957V	probably benign	Het
Eps15	T	A	4: 109,227,866 (GRCm39)	S549R	probably damaging	Het
Fbxo3	C	A	2: 103,885,330 (GRCm39)	H400N	probably benign	Het
Fcer1a	A	G	1: 173,050,264 (GRCm39)	V86A	probably damaging	Het
Fh1	A	G	1: 175,442,406 (GRCm39)	M148T	possibly damaging	Het
Foxc1	C	A	13: 31,992,586 (GRCm39)	H466N	unknown	Het
Gadl1	T	A	9: 115,778,626 (GRCm39)	I180N	possibly damaging	Het
Gm10801	G	C	2: 98,494,352 (GRCm39)	R143T	possibly damaging	Het
Gm21718	T	C	14: 51,555,223 (GRCm39)		noncoding transcript	Het
Hivep2	T	A	10: 14,003,970 (GRCm39)	Y189*	probably null	Het
Hspd1	A	G	1: 55,117,697 (GRCm39)		probably benign	Het
Il1r1	A	G	1: 40,334,023 (GRCm39)	M198V	probably benign	Het
Katnal1	T	A	5: 148,825,746 (GRCm39)	I362F	probably damaging	Het
Muc2	CGTG	CGTGTG	7: 141,699,185 (GRCm38)		probably null	Het
Mybpc1	T	C	10: 88,376,804 (GRCm39)		probably benign	Het
Mycbp2	A	G	14: 103,407,291 (GRCm39)		probably null	Het
Nell2	G	T	15: 95,327,859 (GRCm39)	N301K	probably damaging	Het
Nenf	T	A	1: 191,042,132 (GRCm39)	D108V	probably damaging	Het
Nfkbiz	T	C	16: 55,638,581 (GRCm39)	N293S	probably benign	Het
Nipbl	T	C	15: 8,366,403 (GRCm39)	K1229E	probably damaging	Het
Nlrp4a	T	C	7: 26,152,822 (GRCm39)	F631L	probably benign	Het
Nrp1	T	A	8: 129,224,352 (GRCm39)	V705E	probably damaging	Het
Nsf	G	C	11: 103,754,159 (GRCm39)	A459G	possibly damaging	Het
Or1af1	A	G	2: 37,110,089 (GRCm39)	E196G	probably damaging	Het
Or5w10	A	G	2: 87,375,238 (GRCm39)	S217P	probably damaging	Het
Pdia4	C	T	6: 47,775,341 (GRCm39)	D490N	possibly damaging	Het
Pinlyp	T	A	7: 24,241,226 (GRCm39)	Y192F	probably benign	Het
Pkd2	T	C	5: 104,603,543 (GRCm39)		probably benign	Het
Ppara	A	G	15: 85,685,247 (GRCm39)	K399E	probably benign	Het
Ppp4r2	C	A	6: 100,842,047 (GRCm39)	N169K	probably damaging	Het
Prom1	T	A	5: 44,171,505 (GRCm39)	E632V	possibly damaging	Het
Rpap3	T	A	15: 97,578,229 (GRCm39)	Y562F	possibly damaging	Het
Rsph14	T	A	10: 74,793,611 (GRCm39)	K263N	probably damaging	Het
Sanbr	T	C	11: 23,526,826 (GRCm39)		probably benign	Het
Scn11a	T	G	9: 119,584,091 (GRCm39)	D1508A	probably damaging	Het
Scn7a	T	C	2: 66,506,300 (GRCm39)	T1530A	probably damaging	Het
Sec14l1	T	A	11: 117,034,108 (GRCm39)		probably null	Het
Slc4a4	A	G	5: 89,362,435 (GRCm39)	I840V	probably damaging	Het
Slco1a8	G	A	6: 141,926,664 (GRCm39)	T554I	possibly damaging	Het
Slco1c1	T	A	6: 141,505,478 (GRCm39)	V419D	probably benign	Het
Sltm	T	A	9: 70,498,964 (GRCm39)	F1013I	probably damaging	Het
Spam1	A	G	6: 24,796,846 (GRCm39)	K266E	probably benign	Het
Syt15	A	G	14: 33,948,073 (GRCm39)	E306G	probably benign	Het
Tap1	A	T	17: 34,408,447 (GRCm39)		probably null	Het
Tbc1d16	G	C	11: 119,045,904 (GRCm39)		probably benign	Het
Tex47	T	C	5: 7,355,022 (GRCm39)	Y68H	probably damaging	Het
Ttn	T	C	2: 76,642,845 (GRCm39)	T13264A	probably damaging	Het
Ttn	A	T	2: 76,641,587 (GRCm39)	L5176Q	possibly damaging	Het
Ubxn2a	A	T	12: 4,935,757 (GRCm39)	F131Y	probably damaging	Het
Usp40	T	C	1: 87,923,580 (GRCm39)		probably benign	Het
Vmn1r170	T	C	7: 23,306,462 (GRCm39)	L288P	probably damaging	Het
Vmn1r175	A	G	7: 23,508,352 (GRCm39)	Y92H	probably benign	Het
Wdpcp	G	T	11: 21,835,015 (GRCm39)	E673*	probably null	Het
Zfr	T	A	15: 12,162,309 (GRCm39)	L820I	probably damaging	Het

Other mutations in Hoxd13

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL03108:Hoxd13	APN	2	74,500,440 (GRCm39)	missense	probably damaging	1.00
R1722:Hoxd13	UTSW	2	74,500,389 (GRCm39)	missense	probably benign	0.34
R4116:Hoxd13	UTSW	2	74,498,832 (GRCm39)	missense	possibly damaging	0.93
R4400:Hoxd13	UTSW	2	74,500,359 (GRCm39)	missense	probably damaging	1.00
R4424:Hoxd13	UTSW	2	74,500,301 (GRCm39)	nonsense	probably null
R4938:Hoxd13	UTSW	2	74,499,027 (GRCm39)	missense	probably benign	0.26
R5535:Hoxd13	UTSW	2	74,499,141 (GRCm39)	missense	probably damaging	0.99
R7054:Hoxd13	UTSW	2	74,499,369 (GRCm39)	missense	probably damaging	1.00
R7069:Hoxd13	UTSW	2	74,499,368 (GRCm39)	missense	probably damaging	1.00
R7677:Hoxd13	UTSW	2	74,498,909 (GRCm39)	missense	probably benign	0.39
R8329:Hoxd13	UTSW	2	74,498,661 (GRCm39)	missense	probably benign	0.06
R8906:Hoxd13	UTSW	2	74,500,266 (GRCm39)	missense
R9130:Hoxd13	UTSW	2	74,499,382 (GRCm39)	missense	probably benign	0.02
R9386:Hoxd13	UTSW	2	74,499,327 (GRCm39)	missense	probably damaging	1.00
R9803:Hoxd13	UTSW	2	74,499,247 (GRCm39)	missense	possibly damaging	0.83

Predicted Primers

PCR Primer
(F):5'- GAAGTACATGGACGTGTCGG -3'
(R):5'- TGCTTCACGGGAAGGAAAAC -3'

Sequencing Primer
(F):5'- GAAGTGTCCTTCTACCAGGGCTAC -3'
(R):5'- CTTCACGGGAAGGAAAACATAGC -3'

Posted On

2014-10-01