Incidental Mutation 'R2163:Ablim2'
ID235267
Institutional Source Beutler Lab
Gene Symbol Ablim2
Ensembl Gene ENSMUSG00000029095
Gene Nameactin-binding LIM protein 2
Synonyms
MMRRC Submission 040166-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.194) question?
Stock #R2163 (G1)
Quality Score107
Status Validated
Chromosome5
Chromosomal Location35757880-35884973 bp(+) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) T to C at 35802353 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000123525 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000054598] [ENSMUST00000101280] [ENSMUST00000114204] [ENSMUST00000114205] [ENSMUST00000114206] [ENSMUST00000114210] [ENSMUST00000129347]
Predicted Effect probably benign
Transcript: ENSMUST00000054598
SMART Domains Protein: ENSMUSP00000050571
Gene: ENSMUSG00000029095

DomainStartEndE-ValueType
LIM 23 74 2.76e-8 SMART
LIM 82 134 1.26e-11 SMART
LIM 152 203 9.6e-17 SMART
LIM 211 263 4.96e-10 SMART
low complexity region 278 296 N/A INTRINSIC
low complexity region 364 373 N/A INTRINSIC
low complexity region 477 489 N/A INTRINSIC
VHP 577 612 2.34e-19 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000101280
SMART Domains Protein: ENSMUSP00000098838
Gene: ENSMUSG00000029095

DomainStartEndE-ValueType
LIM 23 74 2.76e-8 SMART
LIM 82 134 1.26e-11 SMART
LIM 152 203 9.6e-17 SMART
LIM 211 263 4.96e-10 SMART
low complexity region 297 315 N/A INTRINSIC
low complexity region 383 392 N/A INTRINSIC
low complexity region 511 523 N/A INTRINSIC
VHP 572 607 2.34e-19 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000114204
SMART Domains Protein: ENSMUSP00000109842
Gene: ENSMUSG00000029095

DomainStartEndE-ValueType
LIM 23 74 2.76e-8 SMART
LIM 82 134 1.26e-11 SMART
LIM 152 203 9.6e-17 SMART
LIM 211 263 4.96e-10 SMART
low complexity region 278 296 N/A INTRINSIC
low complexity region 364 373 N/A INTRINSIC
low complexity region 510 522 N/A INTRINSIC
VHP 571 606 2.34e-19 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000114205
SMART Domains Protein: ENSMUSP00000109843
Gene: ENSMUSG00000029095

DomainStartEndE-ValueType
LIM 23 74 2.76e-8 SMART
LIM 82 134 1.26e-11 SMART
LIM 152 203 9.6e-17 SMART
LIM 211 263 4.96e-10 SMART
low complexity region 278 296 N/A INTRINSIC
low complexity region 364 373 N/A INTRINSIC
low complexity region 477 489 N/A INTRINSIC
VHP 538 573 2.34e-19 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000114206
SMART Domains Protein: ENSMUSP00000109844
Gene: ENSMUSG00000029095

DomainStartEndE-ValueType
LIM 23 74 2.76e-8 SMART
LIM 82 134 1.26e-11 SMART
LIM 152 203 9.6e-17 SMART
LIM 211 263 4.96e-10 SMART
low complexity region 278 296 N/A INTRINSIC
low complexity region 375 384 N/A INTRINSIC
low complexity region 521 533 N/A INTRINSIC
VHP 582 617 2.34e-19 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000114210
SMART Domains Protein: ENSMUSP00000109848
Gene: ENSMUSG00000029095

DomainStartEndE-ValueType
LIM 23 74 2.76e-8 SMART
LIM 82 134 1.26e-11 SMART
LIM 152 203 9.6e-17 SMART
LIM 211 263 4.96e-10 SMART
low complexity region 278 296 N/A INTRINSIC
low complexity region 364 373 N/A INTRINSIC
low complexity region 510 522 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000129347
SMART Domains Protein: ENSMUSP00000123525
Gene: ENSMUSG00000029095

DomainStartEndE-ValueType
LIM 23 74 2.76e-8 SMART
LIM 82 134 1.26e-11 SMART
LIM 152 203 9.6e-17 SMART
LIM 211 263 4.96e-10 SMART
Pfam:AbLIM_anchor 295 513 2.1e-78 PFAM
Pfam:AbLIM_anchor 497 628 2.6e-37 PFAM
VHP 629 664 2.34e-19 SMART
Meta Mutation Damage Score 0.1236 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.6%
  • 20x: 95.9%
Validation Efficiency 97% (76/78)
Allele List at MGI
Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610010F05Rik T C 11: 23,576,826 probably benign Het
2410089E03Rik T A 15: 8,203,251 probably null Het
4930578I07Rik C A 14: 66,938,548 T64K unknown Het
Acp4 T C 7: 44,255,976 D107G probably damaging Het
Adamts2 T A 11: 50,788,805 C871S probably benign Het
Adamts3 A G 5: 89,708,718 V332A probably damaging Het
Alkal1 C T 1: 6,389,512 T104M probably benign Het
Astn1 A G 1: 158,502,150 S192G probably damaging Het
Axdnd1 A C 1: 156,392,003 V337G probably damaging Het
Baiap2l2 T C 15: 79,259,195 D481G possibly damaging Het
Cacna2d1 C T 5: 16,362,319 T964I probably damaging Het
Carf T C 1: 60,147,486 probably benign Het
Catsper2 T C 2: 121,400,175 D295G probably damaging Het
Cdh1 A G 8: 106,649,081 T84A probably benign Het
Chd8 T A 14: 52,198,818 H2508L possibly damaging Het
Chl1 A T 6: 103,711,231 T284S probably damaging Het
Chtop A T 3: 90,502,211 M125K probably benign Het
Col14a1 T A 15: 55,444,645 probably benign Het
Cyp2b10 A T 7: 25,925,385 probably benign Het
Cyp2c70 G A 19: 40,160,719 H328Y possibly damaging Het
Dcbld1 A G 10: 52,286,356 T77A probably damaging Het
Dnah6 A T 6: 73,089,746 probably null Het
Efhd1 A T 1: 87,289,473 D104V probably damaging Het
Eif5b A T 1: 38,048,794 D957V probably benign Het
Eps15 T A 4: 109,370,669 S549R probably damaging Het
Fbxo3 C A 2: 104,054,985 H400N probably benign Het
Fcer1a A G 1: 173,222,697 V86A probably damaging Het
Fh1 A G 1: 175,614,840 M148T possibly damaging Het
Foxc1 C A 13: 31,808,603 H466N unknown Het
Gadl1 T A 9: 115,949,558 I180N possibly damaging Het
Gm10801 G C 2: 98,664,007 R143T possibly damaging Het
Gm21718 T C 14: 51,317,766 noncoding transcript Het
Gm6614 G A 6: 141,980,938 T554I possibly damaging Het
Hivep2 T A 10: 14,128,226 Y189* probably null Het
Hoxd13 T A 2: 74,669,069 S254T possibly damaging Het
Hspd1 A G 1: 55,078,538 probably benign Het
Il1r1 A G 1: 40,294,863 M198V probably benign Het
Katnal1 T A 5: 148,888,936 I362F probably damaging Het
Muc2 CGTG CGTGTG 7: 141,699,185 probably null Het
Mybpc1 T C 10: 88,540,942 probably benign Het
Mycbp2 A G 14: 103,169,855 probably null Het
Nell2 G T 15: 95,429,978 N301K probably damaging Het
Nenf T A 1: 191,309,935 D108V probably damaging Het
Nfkbiz T C 16: 55,818,218 N293S probably benign Het
Nipbl T C 15: 8,336,919 K1229E probably damaging Het
Nlrp4a T C 7: 26,453,397 F631L probably benign Het
Nrp1 T A 8: 128,497,871 V705E probably damaging Het
Nsf G C 11: 103,863,333 A459G possibly damaging Het
Olfr1128 A G 2: 87,544,894 S217P probably damaging Het
Olfr366 A G 2: 37,220,077 E196G probably damaging Het
Pdia4 C T 6: 47,798,407 D490N possibly damaging Het
Pinlyp T A 7: 24,541,801 Y192F probably benign Het
Pkd2 T C 5: 104,455,677 probably benign Het
Ppara A G 15: 85,801,046 K399E probably benign Het
Ppp4r2 C A 6: 100,865,086 N169K probably damaging Het
Prom1 T A 5: 44,014,163 E632V possibly damaging Het
Rpap3 T A 15: 97,680,348 Y562F possibly damaging Het
Rsph14 T A 10: 74,957,779 K263N probably damaging Het
Scn11a T G 9: 119,755,025 D1508A probably damaging Het
Scn7a T C 2: 66,675,956 T1530A probably damaging Het
Sec14l1 T A 11: 117,143,282 probably null Het
Slc4a4 A G 5: 89,214,576 I840V probably damaging Het
Slco1c1 T A 6: 141,559,752 V419D probably benign Het
Sltm T A 9: 70,591,682 F1013I probably damaging Het
Spam1 A G 6: 24,796,847 K266E probably benign Het
Syt15 A G 14: 34,226,116 E306G probably benign Het
Tap1 A T 17: 34,189,473 probably null Het
Tbc1d16 G C 11: 119,155,078 probably benign Het
Tex47 T C 5: 7,305,022 Y68H probably damaging Het
Ttn A T 2: 76,811,243 L5176Q possibly damaging Het
Ttn T C 2: 76,812,501 T13264A probably damaging Het
Ubxn2a A T 12: 4,885,757 F131Y probably damaging Het
Usp40 T C 1: 87,995,858 probably benign Het
Vmn1r170 T C 7: 23,607,037 L288P probably damaging Het
Vmn1r175 A G 7: 23,808,927 Y92H probably benign Het
Wdpcp G T 11: 21,885,015 E673* probably null Het
Zfr T A 15: 12,162,223 L820I probably damaging Het
Other mutations in Ablim2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00939:Ablim2 APN 5 35824015 unclassified probably benign
IGL00945:Ablim2 APN 5 35837020 missense probably damaging 1.00
IGL02439:Ablim2 APN 5 35857862 missense possibly damaging 0.89
IGL02664:Ablim2 APN 5 35849516 missense probably damaging 1.00
IGL02897:Ablim2 APN 5 35833126 missense probably damaging 1.00
IGL03034:Ablim2 APN 5 35828165 missense probably benign 0.00
IGL03096:Ablim2 APN 5 35883399 nonsense probably null
IGL03384:Ablim2 APN 5 35874872 missense probably damaging 1.00
R0128:Ablim2 UTSW 5 35809176 splice site probably benign
R0130:Ablim2 UTSW 5 35809176 splice site probably benign
R0212:Ablim2 UTSW 5 35848910 splice site probably null
R0344:Ablim2 UTSW 5 35836933 splice site probably benign
R0675:Ablim2 UTSW 5 35866780 splice site probably benign
R0788:Ablim2 UTSW 5 35857901 missense probably benign 0.01
R1148:Ablim2 UTSW 5 35809261 missense probably damaging 1.00
R1148:Ablim2 UTSW 5 35809261 missense probably damaging 1.00
R1493:Ablim2 UTSW 5 35809261 missense probably damaging 1.00
R1809:Ablim2 UTSW 5 35843270 intron probably benign
R2070:Ablim2 UTSW 5 35798513 missense probably damaging 1.00
R3962:Ablim2 UTSW 5 35812175 missense probably damaging 1.00
R4852:Ablim2 UTSW 5 35802422 missense possibly damaging 0.85
R4853:Ablim2 UTSW 5 35802422 missense possibly damaging 0.85
R4854:Ablim2 UTSW 5 35802422 missense possibly damaging 0.85
R4855:Ablim2 UTSW 5 35802422 missense possibly damaging 0.85
R4866:Ablim2 UTSW 5 35802422 missense possibly damaging 0.85
R4867:Ablim2 UTSW 5 35802422 missense possibly damaging 0.85
R4906:Ablim2 UTSW 5 35802422 missense possibly damaging 0.85
R4908:Ablim2 UTSW 5 35802422 missense possibly damaging 0.85
R4909:Ablim2 UTSW 5 35802422 missense possibly damaging 0.85
R4927:Ablim2 UTSW 5 35802422 missense possibly damaging 0.85
R5210:Ablim2 UTSW 5 35837072 missense probably benign 0.44
R5225:Ablim2 UTSW 5 35866771 splice site probably null
R5439:Ablim2 UTSW 5 35857826 missense probably damaging 0.98
R5528:Ablim2 UTSW 5 35856166 nonsense probably null
R5629:Ablim2 UTSW 5 35857163 missense probably benign 0.01
R5653:Ablim2 UTSW 5 35883412 missense probably damaging 1.00
R5921:Ablim2 UTSW 5 35812211 missense probably damaging 1.00
R6059:Ablim2 UTSW 5 35857164 missense probably benign 0.37
R6241:Ablim2 UTSW 5 35874897 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCTCAGTGCTTCTTTCTGGAAG -3'
(R):5'- TAGACCACTTACCTGCAGACAG -3'

Sequencing Primer
(F):5'- CTGGAAGCTTCTGTATGGGAAATAC -3'
(R):5'- GCACACACGAAGCAGTCAGG -3'
Posted On2014-10-01