Incidental Mutation 'R2163:Mybpc1'
ID235296
Institutional Source Beutler Lab
Gene Symbol Mybpc1
Ensembl Gene ENSMUSG00000020061
Gene Namemyosin binding protein C, slow-type
Synonyms8030451F13Rik, Slow-type C-protein
MMRRC Submission 040166-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.733) question?
Stock #R2163 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location88518279-88605152 bp(-) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) T to C at 88540942 bp
ZygosityHeterozygous
Amino Acid Change
Gene Model predicted gene model for transcript(s): [ENSMUST00000119185] [ENSMUST00000121629]
Predicted Effect probably benign
Transcript: ENSMUST00000119185
SMART Domains Protein: ENSMUSP00000112699
Gene: ENSMUSG00000020061

DomainStartEndE-ValueType
IG 51 147 1.96e-6 SMART
low complexity region 221 233 N/A INTRINSIC
IG 246 325 4.53e-2 SMART
IG 335 416 1.13e-2 SMART
IG 426 506 6.97e-3 SMART
IG 519 604 2.83e-3 SMART
FN3 607 690 4.28e-10 SMART
FN3 705 788 1.49e-9 SMART
low complexity region 800 812 N/A INTRINSIC
IG 815 898 9.06e-2 SMART
FN3 901 983 2.06e-12 SMART
IGc2 1028 1095 1.88e-8 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000121629
SMART Domains Protein: ENSMUSP00000112615
Gene: ENSMUSG00000020061

DomainStartEndE-ValueType
low complexity region 8 27 N/A INTRINSIC
IG 65 161 1.96e-6 SMART
low complexity region 235 247 N/A INTRINSIC
IG 260 339 4.53e-2 SMART
IG 349 430 1.13e-2 SMART
IG 440 520 6.97e-3 SMART
IG 533 618 2.83e-3 SMART
FN3 621 704 4.28e-10 SMART
FN3 719 802 1.49e-9 SMART
low complexity region 814 826 N/A INTRINSIC
IG 829 912 9.06e-2 SMART
FN3 915 997 2.06e-12 SMART
IGc2 1042 1109 1.88e-8 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148205
Predicted Effect probably benign
Transcript: ENSMUST00000153964
SMART Domains Protein: ENSMUSP00000122472
Gene: ENSMUSG00000020061

DomainStartEndE-ValueType
PDB:2YUW|A 2 52 2e-25 PDB
low complexity region 53 65 N/A INTRINSIC
IG 68 151 9.06e-2 SMART
FN3 154 236 2.06e-12 SMART
IGc2 281 348 1.88e-8 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000156573
SMART Domains Protein: ENSMUSP00000119024
Gene: ENSMUSG00000020061

DomainStartEndE-ValueType
PDB:1X44|A 2 58 1e-26 PDB
IG 66 146 6.97e-3 SMART
IG 159 244 2.83e-3 SMART
FN3 247 330 4.28e-10 SMART
FN3 345 446 1.6e-9 SMART
low complexity region 458 470 N/A INTRINSIC
IG 473 556 9.06e-2 SMART
FN3 559 617 8.17e0 SMART
Meta Mutation Damage Score 0.1 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.6%
  • 20x: 95.9%
Validation Efficiency 97% (76/78)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the myosin-binding protein C family. Myosin-binding protein C family members are myosin-associated proteins found in the cross-bridge-bearing zone (C region) of A bands in striated muscle. The encoded protein is the slow skeletal muscle isoform of myosin-binding protein C and plays an important role in muscle contraction by recruiting muscle-type creatine kinase to myosin filaments. Mutations in this gene are associated with distal arthrogryposis type I. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Dec 2011]
Allele List at MGI
Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610010F05Rik T C 11: 23,576,826 probably benign Het
2410089E03Rik T A 15: 8,203,251 probably null Het
4930578I07Rik C A 14: 66,938,548 T64K unknown Het
Ablim2 T C 5: 35,802,353 probably benign Het
Acp4 T C 7: 44,255,976 D107G probably damaging Het
Adamts2 T A 11: 50,788,805 C871S probably benign Het
Adamts3 A G 5: 89,708,718 V332A probably damaging Het
Alkal1 C T 1: 6,389,512 T104M probably benign Het
Astn1 A G 1: 158,502,150 S192G probably damaging Het
Axdnd1 A C 1: 156,392,003 V337G probably damaging Het
Baiap2l2 T C 15: 79,259,195 D481G possibly damaging Het
Cacna2d1 C T 5: 16,362,319 T964I probably damaging Het
Carf T C 1: 60,147,486 probably benign Het
Catsper2 T C 2: 121,400,175 D295G probably damaging Het
Cdh1 A G 8: 106,649,081 T84A probably benign Het
Chd8 T A 14: 52,198,818 H2508L possibly damaging Het
Chl1 A T 6: 103,711,231 T284S probably damaging Het
Chtop A T 3: 90,502,211 M125K probably benign Het
Col14a1 T A 15: 55,444,645 probably benign Het
Cyp2b10 A T 7: 25,925,385 probably benign Het
Cyp2c70 G A 19: 40,160,719 H328Y possibly damaging Het
Dcbld1 A G 10: 52,286,356 T77A probably damaging Het
Dnah6 A T 6: 73,089,746 probably null Het
Efhd1 A T 1: 87,289,473 D104V probably damaging Het
Eif5b A T 1: 38,048,794 D957V probably benign Het
Eps15 T A 4: 109,370,669 S549R probably damaging Het
Fbxo3 C A 2: 104,054,985 H400N probably benign Het
Fcer1a A G 1: 173,222,697 V86A probably damaging Het
Fh1 A G 1: 175,614,840 M148T possibly damaging Het
Foxc1 C A 13: 31,808,603 H466N unknown Het
Gadl1 T A 9: 115,949,558 I180N possibly damaging Het
Gm10801 G C 2: 98,664,007 R143T possibly damaging Het
Gm21718 T C 14: 51,317,766 noncoding transcript Het
Gm6614 G A 6: 141,980,938 T554I possibly damaging Het
Hivep2 T A 10: 14,128,226 Y189* probably null Het
Hoxd13 T A 2: 74,669,069 S254T possibly damaging Het
Hspd1 A G 1: 55,078,538 probably benign Het
Il1r1 A G 1: 40,294,863 M198V probably benign Het
Katnal1 T A 5: 148,888,936 I362F probably damaging Het
Muc2 CGTG CGTGTG 7: 141,699,185 probably null Het
Mycbp2 A G 14: 103,169,855 probably null Het
Nell2 G T 15: 95,429,978 N301K probably damaging Het
Nenf T A 1: 191,309,935 D108V probably damaging Het
Nfkbiz T C 16: 55,818,218 N293S probably benign Het
Nipbl T C 15: 8,336,919 K1229E probably damaging Het
Nlrp4a T C 7: 26,453,397 F631L probably benign Het
Nrp1 T A 8: 128,497,871 V705E probably damaging Het
Nsf G C 11: 103,863,333 A459G possibly damaging Het
Olfr1128 A G 2: 87,544,894 S217P probably damaging Het
Olfr366 A G 2: 37,220,077 E196G probably damaging Het
Pdia4 C T 6: 47,798,407 D490N possibly damaging Het
Pinlyp T A 7: 24,541,801 Y192F probably benign Het
Pkd2 T C 5: 104,455,677 probably benign Het
Ppara A G 15: 85,801,046 K399E probably benign Het
Ppp4r2 C A 6: 100,865,086 N169K probably damaging Het
Prom1 T A 5: 44,014,163 E632V possibly damaging Het
Rpap3 T A 15: 97,680,348 Y562F possibly damaging Het
Rsph14 T A 10: 74,957,779 K263N probably damaging Het
Scn11a T G 9: 119,755,025 D1508A probably damaging Het
Scn7a T C 2: 66,675,956 T1530A probably damaging Het
Sec14l1 T A 11: 117,143,282 probably null Het
Slc4a4 A G 5: 89,214,576 I840V probably damaging Het
Slco1c1 T A 6: 141,559,752 V419D probably benign Het
Sltm T A 9: 70,591,682 F1013I probably damaging Het
Spam1 A G 6: 24,796,847 K266E probably benign Het
Syt15 A G 14: 34,226,116 E306G probably benign Het
Tap1 A T 17: 34,189,473 probably null Het
Tbc1d16 G C 11: 119,155,078 probably benign Het
Tex47 T C 5: 7,305,022 Y68H probably damaging Het
Ttn A T 2: 76,811,243 L5176Q possibly damaging Het
Ttn T C 2: 76,812,501 T13264A probably damaging Het
Ubxn2a A T 12: 4,885,757 F131Y probably damaging Het
Usp40 T C 1: 87,995,858 probably benign Het
Vmn1r170 T C 7: 23,607,037 L288P probably damaging Het
Vmn1r175 A G 7: 23,808,927 Y92H probably benign Het
Wdpcp G T 11: 21,885,015 E673* probably null Het
Zfr T A 15: 12,162,223 L820I probably damaging Het
Other mutations in Mybpc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00468:Mybpc1 APN 10 88549262 missense probably damaging 0.98
IGL00577:Mybpc1 APN 10 88536384 missense probably damaging 1.00
IGL00703:Mybpc1 APN 10 88525108 splice site probably null
IGL00964:Mybpc1 APN 10 88555742 critical splice acceptor site probably null
IGL01738:Mybpc1 APN 10 88570645 missense probably damaging 1.00
IGL01978:Mybpc1 APN 10 88531770 missense probably damaging 1.00
IGL02255:Mybpc1 APN 10 88536428 missense probably damaging 1.00
IGL02997:Mybpc1 APN 10 88526373 missense probably damaging 1.00
R0098:Mybpc1 UTSW 10 88529564 missense probably benign 0.02
R0240:Mybpc1 UTSW 10 88555738 missense possibly damaging 0.59
R0240:Mybpc1 UTSW 10 88555738 missense possibly damaging 0.59
R0449:Mybpc1 UTSW 10 88540960 missense probably damaging 1.00
R0879:Mybpc1 UTSW 10 88571516 splice site probably benign
R1321:Mybpc1 UTSW 10 88529541 missense possibly damaging 0.85
R1321:Mybpc1 UTSW 10 88570601 missense probably damaging 1.00
R1562:Mybpc1 UTSW 10 88553331 missense probably damaging 1.00
R1783:Mybpc1 UTSW 10 88570568 missense probably damaging 1.00
R1803:Mybpc1 UTSW 10 88553295 missense possibly damaging 0.65
R1962:Mybpc1 UTSW 10 88548826 missense probably damaging 1.00
R1972:Mybpc1 UTSW 10 88551542 missense probably benign 0.00
R2006:Mybpc1 UTSW 10 88546059 missense probably damaging 0.99
R2125:Mybpc1 UTSW 10 88573437 nonsense probably null
R2129:Mybpc1 UTSW 10 88551452 missense probably damaging 1.00
R2200:Mybpc1 UTSW 10 88555695 missense probably damaging 1.00
R2219:Mybpc1 UTSW 10 88555678 missense probably damaging 1.00
R2270:Mybpc1 UTSW 10 88551407 missense probably benign 0.01
R2961:Mybpc1 UTSW 10 88531779 missense probably damaging 1.00
R3767:Mybpc1 UTSW 10 88570659 splice site probably null
R4032:Mybpc1 UTSW 10 88529564 missense probably benign 0.02
R4226:Mybpc1 UTSW 10 88573525 nonsense probably null
R4821:Mybpc1 UTSW 10 88548865 missense probably damaging 0.98
R4876:Mybpc1 UTSW 10 88522991 missense probably benign
R4876:Mybpc1 UTSW 10 88536424 missense probably benign 0.03
R4878:Mybpc1 UTSW 10 88551430 missense possibly damaging 0.95
R4910:Mybpc1 UTSW 10 88555724 nonsense probably null
R4913:Mybpc1 UTSW 10 88553254 critical splice donor site probably null
R4964:Mybpc1 UTSW 10 88555663 missense probably benign 0.31
R5023:Mybpc1 UTSW 10 88543774 missense probably damaging 1.00
R5098:Mybpc1 UTSW 10 88546064 missense probably damaging 1.00
R5196:Mybpc1 UTSW 10 88536351 missense probably damaging 0.97
R5344:Mybpc1 UTSW 10 88570568 missense probably damaging 1.00
R5399:Mybpc1 UTSW 10 88523014 missense probably damaging 1.00
R5538:Mybpc1 UTSW 10 88546029 missense possibly damaging 0.89
R5808:Mybpc1 UTSW 10 88570566 missense possibly damaging 0.83
R5970:Mybpc1 UTSW 10 88542456 missense probably damaging 1.00
R6324:Mybpc1 UTSW 10 88568619 missense possibly damaging 0.56
R6433:Mybpc1 UTSW 10 88560355 missense probably damaging 1.00
R6441:Mybpc1 UTSW 10 88553277 missense probably benign 0.09
R6648:Mybpc1 UTSW 10 88522999 missense probably damaging 0.96
R6844:Mybpc1 UTSW 10 88536381 missense possibly damaging 0.50
R6931:Mybpc1 UTSW 10 88542330 nonsense probably null
R6972:Mybpc1 UTSW 10 88560361 missense possibly damaging 0.50
R6973:Mybpc1 UTSW 10 88560361 missense possibly damaging 0.50
R6978:Mybpc1 UTSW 10 88523024 missense probably damaging 1.00
R7007:Mybpc1 UTSW 10 88553412 missense probably damaging 1.00
R7019:Mybpc1 UTSW 10 88543719 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGGTGATGACTGGCTTTACAGC -3'
(R):5'- ACTCATGGCTGCATCTTCTG -3'

Sequencing Primer
(F):5'- CTGTTTTAGCATCTACATTTGTAGCG -3'
(R):5'- ATGGCTGCATCTTCTGACTTC -3'
Posted On2014-10-01