Incidental Mutation 'R2163:2410089E03Rik'
ID235310
Institutional Source Beutler Lab
Gene Symbol 2410089E03Rik
Ensembl Gene ENSMUSG00000039801
Gene NameRIKEN cDNA 2410089E03 gene
Synonymsb2b012Clo
MMRRC Submission 040166-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R2163 (G1)
Quality Score225
Status Validated
Chromosome15
Chromosomal Location8169106-8271158 bp(+) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) T to A at 8203251 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000106247 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000110617]
Predicted Effect probably null
Transcript: ENSMUST00000110617
SMART Domains Protein: ENSMUSP00000106247
Gene: ENSMUSG00000039801

DomainStartEndE-ValueType
low complexity region 144 157 N/A INTRINSIC
low complexity region 338 352 N/A INTRINSIC
low complexity region 466 476 N/A INTRINSIC
low complexity region 868 883 N/A INTRINSIC
low complexity region 949 962 N/A INTRINSIC
low complexity region 1400 1415 N/A INTRINSIC
low complexity region 1449 1464 N/A INTRINSIC
low complexity region 1827 1838 N/A INTRINSIC
low complexity region 1919 1930 N/A INTRINSIC
low complexity region 2130 2145 N/A INTRINSIC
coiled coil region 2750 2782 N/A INTRINSIC
low complexity region 2838 2850 N/A INTRINSIC
Pfam:Joubert 2894 3207 1.9e-136 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130748
Meta Mutation Damage Score 0.6312 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.6%
  • 20x: 95.9%
Validation Efficiency 97% (76/78)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene has putative coiled-coil domains and may be a transmembrane protein. Defects in this gene are a cause of Joubert syndrome (JBTS). [provided by RefSeq, May 2012]
PHENOTYPE: Homozygotes exhibit double outlet right ventricle {SDD}, pulmonary atresia/hypolastic pulmonary artery, atrioventricular septal defect, and right aortic arch. Non-cardiovascular defects include cleft palate, polydactyly, transparent chest wall (sternal bone hypoplasia) and hypoplastic lungs. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610010F05Rik T C 11: 23,576,826 probably benign Het
4930578I07Rik C A 14: 66,938,548 T64K unknown Het
Ablim2 T C 5: 35,802,353 probably benign Het
Acp4 T C 7: 44,255,976 D107G probably damaging Het
Adamts2 T A 11: 50,788,805 C871S probably benign Het
Adamts3 A G 5: 89,708,718 V332A probably damaging Het
Alkal1 C T 1: 6,389,512 T104M probably benign Het
Astn1 A G 1: 158,502,150 S192G probably damaging Het
Axdnd1 A C 1: 156,392,003 V337G probably damaging Het
Baiap2l2 T C 15: 79,259,195 D481G possibly damaging Het
Cacna2d1 C T 5: 16,362,319 T964I probably damaging Het
Carf T C 1: 60,147,486 probably benign Het
Catsper2 T C 2: 121,400,175 D295G probably damaging Het
Cdh1 A G 8: 106,649,081 T84A probably benign Het
Chd8 T A 14: 52,198,818 H2508L possibly damaging Het
Chl1 A T 6: 103,711,231 T284S probably damaging Het
Chtop A T 3: 90,502,211 M125K probably benign Het
Col14a1 T A 15: 55,444,645 probably benign Het
Cyp2b10 A T 7: 25,925,385 probably benign Het
Cyp2c70 G A 19: 40,160,719 H328Y possibly damaging Het
Dcbld1 A G 10: 52,286,356 T77A probably damaging Het
Dnah6 A T 6: 73,089,746 probably null Het
Efhd1 A T 1: 87,289,473 D104V probably damaging Het
Eif5b A T 1: 38,048,794 D957V probably benign Het
Eps15 T A 4: 109,370,669 S549R probably damaging Het
Fbxo3 C A 2: 104,054,985 H400N probably benign Het
Fcer1a A G 1: 173,222,697 V86A probably damaging Het
Fh1 A G 1: 175,614,840 M148T possibly damaging Het
Foxc1 C A 13: 31,808,603 H466N unknown Het
Gadl1 T A 9: 115,949,558 I180N possibly damaging Het
Gm10801 G C 2: 98,664,007 R143T possibly damaging Het
Gm21718 T C 14: 51,317,766 noncoding transcript Het
Gm6614 G A 6: 141,980,938 T554I possibly damaging Het
Hivep2 T A 10: 14,128,226 Y189* probably null Het
Hoxd13 T A 2: 74,669,069 S254T possibly damaging Het
Hspd1 A G 1: 55,078,538 probably benign Het
Il1r1 A G 1: 40,294,863 M198V probably benign Het
Katnal1 T A 5: 148,888,936 I362F probably damaging Het
Muc2 CGTG CGTGTG 7: 141,699,185 probably null Het
Mybpc1 T C 10: 88,540,942 probably benign Het
Mycbp2 A G 14: 103,169,855 probably null Het
Nell2 G T 15: 95,429,978 N301K probably damaging Het
Nenf T A 1: 191,309,935 D108V probably damaging Het
Nfkbiz T C 16: 55,818,218 N293S probably benign Het
Nipbl T C 15: 8,336,919 K1229E probably damaging Het
Nlrp4a T C 7: 26,453,397 F631L probably benign Het
Nrp1 T A 8: 128,497,871 V705E probably damaging Het
Nsf G C 11: 103,863,333 A459G possibly damaging Het
Olfr1128 A G 2: 87,544,894 S217P probably damaging Het
Olfr366 A G 2: 37,220,077 E196G probably damaging Het
Pdia4 C T 6: 47,798,407 D490N possibly damaging Het
Pinlyp T A 7: 24,541,801 Y192F probably benign Het
Pkd2 T C 5: 104,455,677 probably benign Het
Ppara A G 15: 85,801,046 K399E probably benign Het
Ppp4r2 C A 6: 100,865,086 N169K probably damaging Het
Prom1 T A 5: 44,014,163 E632V possibly damaging Het
Rpap3 T A 15: 97,680,348 Y562F possibly damaging Het
Rsph14 T A 10: 74,957,779 K263N probably damaging Het
Scn11a T G 9: 119,755,025 D1508A probably damaging Het
Scn7a T C 2: 66,675,956 T1530A probably damaging Het
Sec14l1 T A 11: 117,143,282 probably null Het
Slc4a4 A G 5: 89,214,576 I840V probably damaging Het
Slco1c1 T A 6: 141,559,752 V419D probably benign Het
Sltm T A 9: 70,591,682 F1013I probably damaging Het
Spam1 A G 6: 24,796,847 K266E probably benign Het
Syt15 A G 14: 34,226,116 E306G probably benign Het
Tap1 A T 17: 34,189,473 probably null Het
Tbc1d16 G C 11: 119,155,078 probably benign Het
Tex47 T C 5: 7,305,022 Y68H probably damaging Het
Ttn A T 2: 76,811,243 L5176Q possibly damaging Het
Ttn T C 2: 76,812,501 T13264A probably damaging Het
Ubxn2a A T 12: 4,885,757 F131Y probably damaging Het
Usp40 T C 1: 87,995,858 probably benign Het
Vmn1r170 T C 7: 23,607,037 L288P probably damaging Het
Vmn1r175 A G 7: 23,808,927 Y92H probably benign Het
Wdpcp G T 11: 21,885,015 E673* probably null Het
Zfr T A 15: 12,162,223 L820I probably damaging Het
Other mutations in 2410089E03Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00756:2410089E03Rik APN 15 8264447 splice site probably benign
IGL00766:2410089E03Rik APN 15 8252164 missense unknown
IGL01483:2410089E03Rik APN 15 8187107 missense probably damaging 0.98
IGL01520:2410089E03Rik APN 15 8221911 missense probably damaging 0.96
IGL01578:2410089E03Rik APN 15 8270710 missense unknown
IGL01701:2410089E03Rik APN 15 8203257 splice site probably benign
IGL01892:2410089E03Rik APN 15 8242265 splice site probably benign
IGL01895:2410089E03Rik APN 15 8229107 missense possibly damaging 0.63
IGL01922:2410089E03Rik APN 15 8270821 missense unknown
IGL01978:2410089E03Rik APN 15 8219382 missense probably damaging 0.98
IGL02031:2410089E03Rik APN 15 8179769 missense probably damaging 0.99
IGL02318:2410089E03Rik APN 15 8175025 missense probably damaging 0.98
IGL02321:2410089E03Rik APN 15 8216572 missense probably benign 0.04
IGL02363:2410089E03Rik APN 15 8218437 missense possibly damaging 0.68
IGL02404:2410089E03Rik APN 15 8187284 missense possibly damaging 0.48
IGL02535:2410089E03Rik APN 15 8174838 missense probably damaging 1.00
IGL02732:2410089E03Rik APN 15 8179891 missense probably benign 0.03
IGL02895:2410089E03Rik APN 15 8232107 splice site probably benign
IGL02903:2410089E03Rik APN 15 8269778 missense unknown
IGL02903:2410089E03Rik APN 15 8269779 missense unknown
IGL02979:2410089E03Rik APN 15 8218554 missense possibly damaging 0.82
IGL03077:2410089E03Rik APN 15 8212795 splice site probably benign
IGL03196:2410089E03Rik APN 15 8201342 missense probably damaging 0.98
IGL03344:2410089E03Rik APN 15 8187458 missense possibly damaging 0.63
IGL03368:2410089E03Rik APN 15 8222373 missense probably benign 0.06
IGL03403:2410089E03Rik APN 15 8201342 missense probably damaging 0.98
agnes UTSW 15 8246938 nonsense probably null
dei UTSW 15 8186165 missense probably damaging 1.00
R0015:2410089E03Rik UTSW 15 8186184 missense probably damaging 1.00
R0015:2410089E03Rik UTSW 15 8186184 missense probably damaging 1.00
R0101:2410089E03Rik UTSW 15 8220960 missense probably benign 0.00
R0105:2410089E03Rik UTSW 15 8187392 missense probably benign
R0105:2410089E03Rik UTSW 15 8187392 missense probably benign
R0165:2410089E03Rik UTSW 15 8216382 missense probably damaging 1.00
R0306:2410089E03Rik UTSW 15 8179889 missense probably damaging 1.00
R0433:2410089E03Rik UTSW 15 8216562 missense probably benign 0.00
R0491:2410089E03Rik UTSW 15 8182243 missense probably damaging 1.00
R0523:2410089E03Rik UTSW 15 8194386 missense probably damaging 1.00
R0571:2410089E03Rik UTSW 15 8259793 missense unknown
R0679:2410089E03Rik UTSW 15 8223122 missense probably benign 0.39
R0704:2410089E03Rik UTSW 15 8210083 missense possibly damaging 0.93
R0707:2410089E03Rik UTSW 15 8258321 missense unknown
R0715:2410089E03Rik UTSW 15 8223092 missense probably benign 0.14
R0762:2410089E03Rik UTSW 15 8218416 unclassified probably benign
R0830:2410089E03Rik UTSW 15 8247185 missense unknown
R0924:2410089E03Rik UTSW 15 8251070 splice site probably benign
R1071:2410089E03Rik UTSW 15 8218426 missense probably benign 0.20
R1184:2410089E03Rik UTSW 15 8216487 missense probably benign
R1224:2410089E03Rik UTSW 15 8178385 missense probably benign 0.06
R1416:2410089E03Rik UTSW 15 8246938 nonsense probably null
R1428:2410089E03Rik UTSW 15 8219369 missense possibly damaging 0.83
R1487:2410089E03Rik UTSW 15 8186231 missense probably damaging 1.00
R1641:2410089E03Rik UTSW 15 8228959 missense probably benign 0.41
R1652:2410089E03Rik UTSW 15 8201146 missense probably damaging 1.00
R1688:2410089E03Rik UTSW 15 8228609 missense probably benign 0.00
R1715:2410089E03Rik UTSW 15 8226900 splice site probably null
R1820:2410089E03Rik UTSW 15 8269645 missense unknown
R1863:2410089E03Rik UTSW 15 8228593 missense probably benign 0.00
R1940:2410089E03Rik UTSW 15 8233852 missense probably damaging 0.98
R1967:2410089E03Rik UTSW 15 8203420 missense probably benign 0.09
R2064:2410089E03Rik UTSW 15 8186165 missense probably damaging 1.00
R2076:2410089E03Rik UTSW 15 8219257 missense possibly damaging 0.93
R2208:2410089E03Rik UTSW 15 8194403 missense probably benign 0.33
R2504:2410089E03Rik UTSW 15 8219216 missense probably damaging 0.99
R2568:2410089E03Rik UTSW 15 8201269 missense possibly damaging 0.70
R2845:2410089E03Rik UTSW 15 8216380 missense probably damaging 1.00
R2913:2410089E03Rik UTSW 15 8270685 missense unknown
R3056:2410089E03Rik UTSW 15 8251007 missense unknown
R3706:2410089E03Rik UTSW 15 8259816 missense unknown
R3707:2410089E03Rik UTSW 15 8259816 missense unknown
R3870:2410089E03Rik UTSW 15 8218464 missense probably damaging 0.98
R3877:2410089E03Rik UTSW 15 8221943 missense probably benign
R3886:2410089E03Rik UTSW 15 8171805 missense probably damaging 0.98
R4057:2410089E03Rik UTSW 15 8219025 missense probably benign 0.08
R4090:2410089E03Rik UTSW 15 8212358 splice site probably null
R4362:2410089E03Rik UTSW 15 8270745 missense unknown
R4363:2410089E03Rik UTSW 15 8270745 missense unknown
R4445:2410089E03Rik UTSW 15 8252188 missense unknown
R4581:2410089E03Rik UTSW 15 8171798 missense possibly damaging 0.85
R4587:2410089E03Rik UTSW 15 8201152 missense possibly damaging 0.50
R4659:2410089E03Rik UTSW 15 8216276 intron probably benign
R4663:2410089E03Rik UTSW 15 8218455 missense probably benign 0.31
R4779:2410089E03Rik UTSW 15 8218838 missense probably benign 0.04
R4812:2410089E03Rik UTSW 15 8201123 splice site probably null
R4850:2410089E03Rik UTSW 15 8262938 missense unknown
R4896:2410089E03Rik UTSW 15 8221937 missense probably benign 0.00
R5273:2410089E03Rik UTSW 15 8244341 missense probably damaging 0.98
R5273:2410089E03Rik UTSW 15 8262938 missense unknown
R5303:2410089E03Rik UTSW 15 8260690 splice site probably null
R5307:2410089E03Rik UTSW 15 8260690 splice site probably null
R5308:2410089E03Rik UTSW 15 8260690 splice site probably null
R5373:2410089E03Rik UTSW 15 8270803 missense unknown
R5374:2410089E03Rik UTSW 15 8270803 missense unknown
R5386:2410089E03Rik UTSW 15 8194413 missense probably damaging 1.00
R5534:2410089E03Rik UTSW 15 8228835 missense probably benign 0.06
R5720:2410089E03Rik UTSW 15 8203687 missense probably benign 0.35
R5891:2410089E03Rik UTSW 15 8188589 missense probably benign 0.00
R5932:2410089E03Rik UTSW 15 8244595 splice site probably null
R6053:2410089E03Rik UTSW 15 8188461 missense probably benign 0.35
R6166:2410089E03Rik UTSW 15 8186560 missense probably benign 0.00
R6245:2410089E03Rik UTSW 15 8178418 missense probably benign 0.01
R6246:2410089E03Rik UTSW 15 8210014 missense probably damaging 1.00
R6541:2410089E03Rik UTSW 15 8219295 missense possibly damaging 0.48
R6622:2410089E03Rik UTSW 15 8244222 missense probably damaging 0.98
R6707:2410089E03Rik UTSW 15 8223122 missense probably benign 0.39
R6729:2410089E03Rik UTSW 15 8188601 splice site probably null
R6805:2410089E03Rik UTSW 15 8244306 missense probably benign 0.07
R6806:2410089E03Rik UTSW 15 8186858 missense possibly damaging 0.55
R6813:2410089E03Rik UTSW 15 8229282 missense probably benign
R6830:2410089E03Rik UTSW 15 8176184 missense probably benign 0.04
R6845:2410089E03Rik UTSW 15 8221904 missense possibly damaging 0.84
R6894:2410089E03Rik UTSW 15 8187368 missense probably damaging 0.99
R6970:2410089E03Rik UTSW 15 8187548 missense probably benign 0.01
R6991:2410089E03Rik UTSW 15 8252206 missense unknown
R7003:2410089E03Rik UTSW 15 8228762 missense probably damaging 0.99
R7088:2410089E03Rik UTSW 15 8218947 missense probably benign 0.16
R7104:2410089E03Rik UTSW 15 8194444 missense possibly damaging 0.83
R7311:2410089E03Rik UTSW 15 8180915 missense probably damaging 1.00
U24488:2410089E03Rik UTSW 15 8182210 missense probably damaging 1.00
X0023:2410089E03Rik UTSW 15 8247031 missense unknown
Predicted Primers PCR Primer
(F):5'- TGCTTACAGCTCAGCAGTAGAAC -3'
(R):5'- ATACAAGTCGACGGGCACTAAG -3'

Sequencing Primer
(F):5'- ACTTGCTTGACATGCACCAGG -3'
(R):5'- AGCCCCACAGCTTCTTGC -3'
Posted On2014-10-01