Incidental Mutation 'R2163:Nipbl'
ID235311
Institutional Source Beutler Lab
Gene Symbol Nipbl
Ensembl Gene ENSMUSG00000022141
Gene NameNIPBL cohesin loading factor
Synonyms4921518A06Rik, 4933421G18Rik
MMRRC Submission 040166-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.984) question?
Stock #R2163 (G1)
Quality Score225
Status Validated
Chromosome15
Chromosomal Location8290617-8444463 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 8336919 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Glutamic Acid at position 1229 (K1229E)
Ref Sequence ENSEMBL: ENSMUSP00000059385 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000052965]
Predicted Effect probably damaging
Transcript: ENSMUST00000052965
AA Change: K1229E

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000059385
Gene: ENSMUSG00000022141
AA Change: K1229E

DomainStartEndE-ValueType
low complexity region 22 41 N/A INTRINSIC
low complexity region 322 338 N/A INTRINSIC
low complexity region 367 376 N/A INTRINSIC
low complexity region 447 462 N/A INTRINSIC
low complexity region 473 490 N/A INTRINSIC
low complexity region 639 652 N/A INTRINSIC
low complexity region 1020 1037 N/A INTRINSIC
low complexity region 1081 1097 N/A INTRINSIC
low complexity region 1102 1107 N/A INTRINSIC
low complexity region 1114 1139 N/A INTRINSIC
low complexity region 1165 1176 N/A INTRINSIC
low complexity region 1389 1396 N/A INTRINSIC
low complexity region 1577 1586 N/A INTRINSIC
coiled coil region 1628 1656 N/A INTRINSIC
Pfam:Cohesin_HEAT 1788 1829 1.1e-14 PFAM
Pfam:Nipped-B_C 2269 2450 2.8e-68 PFAM
low complexity region 2477 2501 N/A INTRINSIC
low complexity region 2502 2512 N/A INTRINSIC
low complexity region 2538 2550 N/A INTRINSIC
low complexity region 2626 2632 N/A INTRINSIC
low complexity region 2660 2684 N/A INTRINSIC
Meta Mutation Damage Score 0.28 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.6%
  • 20x: 95.9%
Validation Efficiency 97% (76/78)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the homolog of the Drosophila melanogaster Nipped-B gene product and fungal Scc2-type sister chromatid cohesion proteins. The Drosophila protein facilitates enhancer-promoter communication of remote enhancers and plays a role in developmental regulation. It is also homologous to a family of chromosomal adherins with broad roles in sister chromatid cohesion, chromosome condensation, and DNA repair. The human protein has a bipartite nuclear targeting sequence and a putative HEAT repeat. Condensins, cohesins and other complexes with chromosome-related functions also contain HEAT repeats. Mutations in this gene result in Cornelia de Lange syndrome, a disorder characterized by dysmorphic facial features, growth delay, limb reduction defects, and mental retardation. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Nullizygous mice are embryonic lethal. Heterozygous null mice are growth-retarded and show various skeletal anomalies. Heterozygotes for a gene-trap allele are small and show craniofacial, heart, eye, hearing and behavioral defects, delayed bone maturation, reduced body fat, and postnatal mortality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610010F05Rik T C 11: 23,576,826 probably benign Het
2410089E03Rik T A 15: 8,203,251 probably null Het
4930578I07Rik C A 14: 66,938,548 T64K unknown Het
Ablim2 T C 5: 35,802,353 probably benign Het
Acp4 T C 7: 44,255,976 D107G probably damaging Het
Adamts2 T A 11: 50,788,805 C871S probably benign Het
Adamts3 A G 5: 89,708,718 V332A probably damaging Het
Alkal1 C T 1: 6,389,512 T104M probably benign Het
Astn1 A G 1: 158,502,150 S192G probably damaging Het
Axdnd1 A C 1: 156,392,003 V337G probably damaging Het
Baiap2l2 T C 15: 79,259,195 D481G possibly damaging Het
Cacna2d1 C T 5: 16,362,319 T964I probably damaging Het
Carf T C 1: 60,147,486 probably benign Het
Catsper2 T C 2: 121,400,175 D295G probably damaging Het
Cdh1 A G 8: 106,649,081 T84A probably benign Het
Chd8 T A 14: 52,198,818 H2508L possibly damaging Het
Chl1 A T 6: 103,711,231 T284S probably damaging Het
Chtop A T 3: 90,502,211 M125K probably benign Het
Col14a1 T A 15: 55,444,645 probably benign Het
Cyp2b10 A T 7: 25,925,385 probably benign Het
Cyp2c70 G A 19: 40,160,719 H328Y possibly damaging Het
Dcbld1 A G 10: 52,286,356 T77A probably damaging Het
Dnah6 A T 6: 73,089,746 probably null Het
Efhd1 A T 1: 87,289,473 D104V probably damaging Het
Eif5b A T 1: 38,048,794 D957V probably benign Het
Eps15 T A 4: 109,370,669 S549R probably damaging Het
Fbxo3 C A 2: 104,054,985 H400N probably benign Het
Fcer1a A G 1: 173,222,697 V86A probably damaging Het
Fh1 A G 1: 175,614,840 M148T possibly damaging Het
Foxc1 C A 13: 31,808,603 H466N unknown Het
Gadl1 T A 9: 115,949,558 I180N possibly damaging Het
Gm10801 G C 2: 98,664,007 R143T possibly damaging Het
Gm21718 T C 14: 51,317,766 noncoding transcript Het
Gm6614 G A 6: 141,980,938 T554I possibly damaging Het
Hivep2 T A 10: 14,128,226 Y189* probably null Het
Hoxd13 T A 2: 74,669,069 S254T possibly damaging Het
Hspd1 A G 1: 55,078,538 probably benign Het
Il1r1 A G 1: 40,294,863 M198V probably benign Het
Katnal1 T A 5: 148,888,936 I362F probably damaging Het
Muc2 CGTG CGTGTG 7: 141,699,185 probably null Het
Mybpc1 T C 10: 88,540,942 probably benign Het
Mycbp2 A G 14: 103,169,855 probably null Het
Nell2 G T 15: 95,429,978 N301K probably damaging Het
Nenf T A 1: 191,309,935 D108V probably damaging Het
Nfkbiz T C 16: 55,818,218 N293S probably benign Het
Nlrp4a T C 7: 26,453,397 F631L probably benign Het
Nrp1 T A 8: 128,497,871 V705E probably damaging Het
Nsf G C 11: 103,863,333 A459G possibly damaging Het
Olfr1128 A G 2: 87,544,894 S217P probably damaging Het
Olfr366 A G 2: 37,220,077 E196G probably damaging Het
Pdia4 C T 6: 47,798,407 D490N possibly damaging Het
Pinlyp T A 7: 24,541,801 Y192F probably benign Het
Pkd2 T C 5: 104,455,677 probably benign Het
Ppara A G 15: 85,801,046 K399E probably benign Het
Ppp4r2 C A 6: 100,865,086 N169K probably damaging Het
Prom1 T A 5: 44,014,163 E632V possibly damaging Het
Rpap3 T A 15: 97,680,348 Y562F possibly damaging Het
Rsph14 T A 10: 74,957,779 K263N probably damaging Het
Scn11a T G 9: 119,755,025 D1508A probably damaging Het
Scn7a T C 2: 66,675,956 T1530A probably damaging Het
Sec14l1 T A 11: 117,143,282 probably null Het
Slc4a4 A G 5: 89,214,576 I840V probably damaging Het
Slco1c1 T A 6: 141,559,752 V419D probably benign Het
Sltm T A 9: 70,591,682 F1013I probably damaging Het
Spam1 A G 6: 24,796,847 K266E probably benign Het
Syt15 A G 14: 34,226,116 E306G probably benign Het
Tap1 A T 17: 34,189,473 probably null Het
Tbc1d16 G C 11: 119,155,078 probably benign Het
Tex47 T C 5: 7,305,022 Y68H probably damaging Het
Ttn A T 2: 76,811,243 L5176Q possibly damaging Het
Ttn T C 2: 76,812,501 T13264A probably damaging Het
Ubxn2a A T 12: 4,885,757 F131Y probably damaging Het
Usp40 T C 1: 87,995,858 probably benign Het
Vmn1r170 T C 7: 23,607,037 L288P probably damaging Het
Vmn1r175 A G 7: 23,808,927 Y92H probably benign Het
Wdpcp G T 11: 21,885,015 E673* probably null Het
Zfr T A 15: 12,162,223 L820I probably damaging Het
Other mutations in Nipbl
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00417:Nipbl APN 15 8366673 missense probably damaging 0.98
IGL00712:Nipbl APN 15 8369474 missense probably damaging 0.97
IGL00789:Nipbl APN 15 8296869 missense probably damaging 1.00
IGL01025:Nipbl APN 15 8350455 missense possibly damaging 0.46
IGL01087:Nipbl APN 15 8350497 missense possibly damaging 0.67
IGL01474:Nipbl APN 15 8311209 missense possibly damaging 0.63
IGL01537:Nipbl APN 15 8350539 missense probably benign
IGL01723:Nipbl APN 15 8335071 missense possibly damaging 0.71
IGL01749:Nipbl APN 15 8361821 missense probably benign 0.13
IGL02398:Nipbl APN 15 8327090 missense probably damaging 1.00
IGL02437:Nipbl APN 15 8359074 missense probably damaging 1.00
IGL02450:Nipbl APN 15 8343574 missense probably damaging 0.99
IGL02477:Nipbl APN 15 8323647 splice site probably null
IGL02547:Nipbl APN 15 8351598 missense probably benign
IGL02678:Nipbl APN 15 8351110 missense possibly damaging 0.92
IGL02679:Nipbl APN 15 8295553 missense probably benign 0.34
IGL03003:Nipbl APN 15 8350314 missense probably damaging 1.00
IGL03117:Nipbl APN 15 8332452 missense probably damaging 1.00
IGL03162:Nipbl APN 15 8338979 missense probably benign 0.37
IGL03224:Nipbl APN 15 8293085 missense probably damaging 0.98
IGL03339:Nipbl APN 15 8350876 missense probably benign 0.12
R0271:Nipbl UTSW 15 8361737 missense possibly damaging 0.76
R0346:Nipbl UTSW 15 8360956 missense probably damaging 0.99
R0347:Nipbl UTSW 15 8350732 missense probably benign
R0422:Nipbl UTSW 15 8351628 missense probably benign
R0486:Nipbl UTSW 15 8338870 splice site probably benign
R0652:Nipbl UTSW 15 8303480 missense probably benign 0.23
R0667:Nipbl UTSW 15 8361004 missense possibly damaging 0.86
R0689:Nipbl UTSW 15 8293078 splice site probably null
R0726:Nipbl UTSW 15 8351555 missense probably benign
R0881:Nipbl UTSW 15 8307612 missense probably damaging 0.98
R0904:Nipbl UTSW 15 8361718 missense probably benign
R0969:Nipbl UTSW 15 8292228 missense probably damaging 1.00
R1401:Nipbl UTSW 15 8372173 missense probably damaging 0.97
R1479:Nipbl UTSW 15 8350289 missense probably benign 0.00
R1495:Nipbl UTSW 15 8351280 missense probably benign 0.00
R1609:Nipbl UTSW 15 8366664 missense probably damaging 1.00
R1679:Nipbl UTSW 15 8302912 missense probably benign 0.31
R1756:Nipbl UTSW 15 8338551 missense possibly damaging 0.91
R1778:Nipbl UTSW 15 8319488 missense probably damaging 1.00
R1835:Nipbl UTSW 15 8343517 missense possibly damaging 0.80
R1883:Nipbl UTSW 15 8327132 missense probably damaging 1.00
R1914:Nipbl UTSW 15 8343630 missense possibly damaging 0.93
R1915:Nipbl UTSW 15 8343630 missense possibly damaging 0.93
R2030:Nipbl UTSW 15 8350287 missense probably damaging 1.00
R2046:Nipbl UTSW 15 8324467 missense probably benign 0.08
R2076:Nipbl UTSW 15 8311207 missense probably benign 0.11
R2170:Nipbl UTSW 15 8293218 missense probably damaging 1.00
R2425:Nipbl UTSW 15 8351482 missense probably benign 0.06
R2475:Nipbl UTSW 15 8335006 missense probably benign 0.05
R2484:Nipbl UTSW 15 8323698 missense probably damaging 0.99
R2970:Nipbl UTSW 15 8311239 missense probably damaging 1.00
R3116:Nipbl UTSW 15 8343592 missense probably benign 0.00
R3620:Nipbl UTSW 15 8333024 missense probably damaging 0.99
R3725:Nipbl UTSW 15 8295661 missense probably damaging 0.97
R3745:Nipbl UTSW 15 8358874 missense probably benign
R3902:Nipbl UTSW 15 8350246 missense possibly damaging 0.94
R3960:Nipbl UTSW 15 8350534 missense probably benign
R4164:Nipbl UTSW 15 8338934 missense probably benign 0.24
R4246:Nipbl UTSW 15 8332432 missense probably damaging 1.00
R4381:Nipbl UTSW 15 8359206 missense probably benign 0.00
R4394:Nipbl UTSW 15 8361861 missense probably benign 0.00
R4439:Nipbl UTSW 15 8338724 missense probably damaging 0.98
R4440:Nipbl UTSW 15 8366658 missense probably damaging 0.98
R4441:Nipbl UTSW 15 8366658 missense probably damaging 0.98
R4672:Nipbl UTSW 15 8302984 missense probably damaging 1.00
R4749:Nipbl UTSW 15 8365829 missense possibly damaging 0.95
R5300:Nipbl UTSW 15 8351497 missense probably benign
R5428:Nipbl UTSW 15 8330296 missense probably benign 0.00
R5641:Nipbl UTSW 15 8366712 missense possibly damaging 0.93
R5643:Nipbl UTSW 15 8358907 missense probably benign
R5644:Nipbl UTSW 15 8358907 missense probably benign
R5681:Nipbl UTSW 15 8301382 missense probably benign 0.22
R5741:Nipbl UTSW 15 8324649 missense possibly damaging 0.47
R5899:Nipbl UTSW 15 8334844 splice site probably null
R5970:Nipbl UTSW 15 8296818 missense probably benign 0.27
R6041:Nipbl UTSW 15 8324264 missense probably damaging 1.00
R6059:Nipbl UTSW 15 8295568 missense probably damaging 1.00
R6213:Nipbl UTSW 15 8334906 missense probably damaging 1.00
R6216:Nipbl UTSW 15 8318383 missense probably damaging 0.99
R6236:Nipbl UTSW 15 8324580 missense possibly damaging 0.88
R6267:Nipbl UTSW 15 8300895 missense possibly damaging 0.46
R6296:Nipbl UTSW 15 8300895 missense possibly damaging 0.46
R6388:Nipbl UTSW 15 8300784 missense probably damaging 0.99
R6427:Nipbl UTSW 15 8351565 missense probably benign
R6707:Nipbl UTSW 15 8324559 missense probably benign 0.01
R6731:Nipbl UTSW 15 8322590 missense probably damaging 1.00
R6921:Nipbl UTSW 15 8303485 missense probably benign 0.28
R7239:Nipbl UTSW 15 8292135 critical splice donor site probably null
X0022:Nipbl UTSW 15 8351715 missense probably benign 0.05
X0027:Nipbl UTSW 15 8323537 missense probably damaging 1.00
Z1088:Nipbl UTSW 15 8307882 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AATCCATTCTTCTGTCAATGCACAC -3'
(R):5'- GCTTACGTGTGGTTTACAGAACTC -3'

Sequencing Primer
(F):5'- CTGTCAATGCACACATAATTTTGG -3'
(R):5'- CGTGTGGTTTACAGAACTCTGAAAC -3'
Posted On2014-10-01