Incidental Mutation 'R0200:Lgr4'
ID23534
Institutional Source Beutler Lab
Gene Symbol Lgr4
Ensembl Gene ENSMUSG00000050199
Gene Nameleucine-rich repeat-containing G protein-coupled receptor 4
SynonymsA930009A08Rik, Gpr48, A330106J01Rik
MMRRC Submission 038457-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0200 (G1)
Quality Score181
Status Not validated
Chromosome2
Chromosomal Location109917647-110014257 bp(+) (GRCm38)
Type of Mutationcritical splice acceptor site
DNA Base Change (assembly) A to G at 109970690 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000047325 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000046548] [ENSMUST00000111037]
Predicted Effect probably null
Transcript: ENSMUST00000046548
SMART Domains Protein: ENSMUSP00000047325
Gene: ENSMUSG00000050199

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
LRRNT 28 61 6.68e-6 SMART
LRR 55 79 1.49e1 SMART
LRR 80 103 1.99e0 SMART
LRR_TYP 104 127 2.75e-3 SMART
LRR_TYP 128 151 2.79e-4 SMART
LRR 152 175 2.54e1 SMART
LRR 176 199 4.65e-1 SMART
LRR_TYP 200 223 1.04e-3 SMART
LRR 224 246 6.4e0 SMART
LRR_TYP 247 270 5.99e-4 SMART
LRR 272 294 9.77e1 SMART
LRR 318 341 3e1 SMART
LRR 343 363 4.71e1 SMART
LRR 364 387 1.49e1 SMART
LRR_TYP 388 411 1.15e-5 SMART
LRR 412 435 3.98e1 SMART
low complexity region 500 516 N/A INTRINSIC
Pfam:7tm_1 555 801 2.7e-10 PFAM
low complexity region 824 837 N/A INTRINSIC
low complexity region 910 924 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000111037
SMART Domains Protein: ENSMUSP00000106666
Gene: ENSMUSG00000050199

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
LRRNT 28 61 6.68e-6 SMART
LRR 55 79 9.77e1 SMART
LRR_TYP 80 103 2.75e-3 SMART
LRR_TYP 104 127 2.79e-4 SMART
LRR 128 151 2.54e1 SMART
LRR 152 175 4.65e-1 SMART
LRR_TYP 176 199 1.04e-3 SMART
LRR 200 222 6.4e0 SMART
LRR_TYP 223 246 5.99e-4 SMART
LRR 248 270 9.77e1 SMART
LRR 294 317 3e1 SMART
LRR 319 339 4.71e1 SMART
LRR 340 363 1.49e1 SMART
LRR_TYP 364 387 1.15e-5 SMART
LRR 388 411 3.98e1 SMART
low complexity region 476 492 N/A INTRINSIC
Pfam:7tm_1 531 777 9.3e-17 PFAM
low complexity region 800 813 N/A INTRINSIC
low complexity region 886 900 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152584
Coding Region Coverage
  • 1x: 98.8%
  • 3x: 97.8%
  • 10x: 94.7%
  • 20x: 86.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a G-protein coupled receptor that binds R-spondins and activates the Wnt signaling pathway. This Wnt signaling pathway activation is necessary for proper development of many organs of the body. [provided by RefSeq, Oct 2016]
PHENOTYPE: Homozygotes for a knock-out allele show embryonic and perinatal death, open eyelids, and abnormal renal development. One gene trap mutation leads to reduced body weight, sterility, and impaired male reproductive tract development. Another gene trap mutation causes ocular anterior segment anomalies. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 86 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A730017C20Rik A G 18: 59,062,459 probably null Het
Aatf T C 11: 84,445,676 K466E probably damaging Het
Abcc3 T C 11: 94,355,074 D1245G probably damaging Het
Adam12 T C 7: 133,974,416 probably null Het
Akap11 A G 14: 78,510,753 V1398A probably benign Het
Ank1 T G 8: 23,096,812 L461R probably damaging Het
Ankfn1 T C 11: 89,441,966 S402G possibly damaging Het
Arhgef40 A C 14: 51,996,974 E911D probably damaging Het
Atp2b1 C T 10: 98,979,814 Q107* probably null Het
BC117090 T C 16: 36,323,024 probably null Het
Cacng3 T A 7: 122,671,785 C4* probably null Het
Ccdc129 T C 6: 55,897,956 L297P probably benign Het
Cds1 G A 5: 101,814,433 V305M probably damaging Het
Cecr2 T G 6: 120,761,797 F1162V probably damaging Het
Cfap70 A T 14: 20,448,563 Y19N probably damaging Het
Chrm5 A G 2: 112,480,720 V17A probably benign Het
Col20a1 T C 2: 181,000,438 I714T probably damaging Het
Cpeb2 T A 5: 43,261,776 M156K possibly damaging Het
Defb25 C A 2: 152,622,412 V71L probably benign Het
Dhx35 A T 2: 158,829,623 M325L probably benign Het
Dhx57 A T 17: 80,251,473 L1019H probably damaging Het
Dnah6 T A 6: 73,069,420 D3195V probably damaging Het
Dph5 A G 3: 115,928,703 S277G probably benign Het
Dpm1 C A 2: 168,223,155 probably null Het
Dsg1a A T 18: 20,340,938 M1023L probably benign Het
Egf A G 3: 129,706,233 Y252H probably benign Het
Egf A G 3: 129,737,549 S126P probably damaging Het
Enam T C 5: 88,493,027 W183R possibly damaging Het
Foxn1 T C 11: 78,361,040 Y455C probably damaging Het
Gm14085 T A 2: 122,527,447 *661R probably null Het
Iars A T 13: 49,726,202 D983V possibly damaging Het
Ikzf4 C A 10: 128,634,676 G325V probably damaging Het
Il1rl1 T A 1: 40,441,303 W31R possibly damaging Het
Ip6k3 C T 17: 27,145,025 D350N probably damaging Het
Irgc1 T C 7: 24,432,006 D462G probably benign Het
Jph3 A G 8: 121,784,833 E520G probably benign Het
Kcna2 T A 3: 107,105,160 D352E probably benign Het
Klk4 T A 7: 43,885,361 I248N probably damaging Het
Krtap16-1 T C 11: 99,985,297 Y427C probably damaging Het
Lhpp C T 7: 132,610,677 probably benign Het
Lypd3 T A 7: 24,640,231 V241D probably damaging Het
Lyz2 T A 10: 117,280,773 N57Y possibly damaging Het
Man1a A G 10: 54,074,498 V176A probably damaging Het
Mcm4 G A 16: 15,629,639 T487I probably benign Het
Mettl21c T A 1: 44,013,654 I68F probably damaging Het
Miip T A 4: 147,862,263 T313S probably damaging Het
Mog A T 17: 37,012,419 I209K probably damaging Het
Myo1c C A 11: 75,672,182 D997E probably benign Het
Npc1 T C 18: 12,219,204 Y146C probably damaging Het
Nploc4 A G 11: 120,413,681 L238P probably damaging Het
Olfr231 T C 1: 174,117,512 H168R probably benign Het
Olfr531 T C 7: 140,400,875 Y57C probably damaging Het
Olfr56 T A 11: 49,135,047 M285K probably damaging Het
Opa1 A G 16: 29,614,129 N544S probably benign Het
Pam C T 1: 97,894,401 probably null Het
Pdgfra T C 5: 75,163,777 Y98H probably damaging Het
Plcz1 C T 6: 139,990,733 R590H probably damaging Het
Plxdc1 T C 11: 97,934,012 Y339C probably damaging Het
Plxna1 T C 6: 89,323,593 N1583S probably damaging Het
Plxna4 C T 6: 32,197,088 V1191M probably damaging Het
Polk T A 13: 96,496,822 N238Y probably benign Het
Ptprq T C 10: 107,685,157 N718S probably benign Het
Rsrc1 A T 3: 67,180,861 H176L probably damaging Het
Sbno1 T C 5: 124,384,541 D1072G probably damaging Het
Scmh1 A G 4: 120,483,831 K238R probably damaging Het
Senp7 A G 16: 56,123,873 T187A possibly damaging Het
Slc12a4 T C 8: 105,951,617 R315G probably benign Het
Slc16a10 A G 10: 40,040,616 V430A probably benign Het
Slc26a7 T C 4: 14,621,317 D23G probably benign Het
Slc7a7 A G 14: 54,377,802 L246P probably damaging Het
Spata7 T A 12: 98,663,169 S332T probably benign Het
Spsb1 A G 4: 149,898,216 *274R probably null Het
Sspo T G 6: 48,486,415 V3767G probably null Het
Syt10 C A 15: 89,826,941 A130S probably benign Het
Tgm6 T A 2: 130,152,945 probably null Het
Them7 A C 2: 105,297,917 N81T probably damaging Het
Tinag C A 9: 76,951,935 A464S probably damaging Het
Tmem217 T G 17: 29,526,310 I149L probably benign Het
Trp53rkb T G 2: 166,795,683 D186E probably damaging Het
Vmn1r20 T C 6: 57,432,099 Y137H probably damaging Het
Vmn1r60 T A 7: 5,544,380 L240F probably benign Het
Vmn1r64 A G 7: 5,883,818 M242T probably benign Het
Xkr4 T C 1: 3,670,663 N229S probably benign Het
Zcchc2 T A 1: 106,004,123 L352M probably damaging Het
Zfp217 C T 2: 170,115,462 A539T probably benign Het
Zfp638 T C 6: 83,967,354 L1018P probably damaging Het
Other mutations in Lgr4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02043:Lgr4 APN 2 110011290 missense probably damaging 1.00
IGL02247:Lgr4 APN 2 110002501 missense probably benign
IGL02247:Lgr4 APN 2 110008075 splice site probably benign
IGL02302:Lgr4 APN 2 110002496 missense probably damaging 0.99
IGL02309:Lgr4 APN 2 110012535 utr 3 prime probably benign
IGL02511:Lgr4 APN 2 110011272 missense probably benign 0.06
IGL02604:Lgr4 APN 2 110011313 missense probably damaging 1.00
IGL02648:Lgr4 APN 2 110012373 missense probably damaging 1.00
IGL02795:Lgr4 APN 2 110008210 splice site probably benign
IGL02899:Lgr4 APN 2 109918253 missense probably damaging 0.99
R0003:Lgr4 UTSW 2 109997665 critical splice donor site probably null
R0314:Lgr4 UTSW 2 109991093 splice site probably benign
R0482:Lgr4 UTSW 2 110008092 missense probably damaging 1.00
R0491:Lgr4 UTSW 2 110007281 splice site probably benign
R0517:Lgr4 UTSW 2 110011320 missense probably damaging 1.00
R0546:Lgr4 UTSW 2 109999421 missense probably damaging 0.98
R0658:Lgr4 UTSW 2 110011787 missense possibly damaging 0.83
R1367:Lgr4 UTSW 2 109991135 missense probably damaging 0.98
R1864:Lgr4 UTSW 2 110011397 missense possibly damaging 0.93
R1977:Lgr4 UTSW 2 110011928 missense probably damaging 1.00
R2239:Lgr4 UTSW 2 110012393 missense probably damaging 1.00
R2380:Lgr4 UTSW 2 110012393 missense probably damaging 1.00
R2383:Lgr4 UTSW 2 110000615 missense probably damaging 1.00
R2997:Lgr4 UTSW 2 110003517 missense probably benign 0.30
R3707:Lgr4 UTSW 2 109970754 missense probably damaging 0.99
R3803:Lgr4 UTSW 2 110008197 missense probably benign 0.10
R3804:Lgr4 UTSW 2 110008197 missense probably benign 0.10
R3843:Lgr4 UTSW 2 109996773 splice site probably benign
R4030:Lgr4 UTSW 2 109989751 missense probably benign 0.06
R4513:Lgr4 UTSW 2 110012016 missense possibly damaging 0.93
R4777:Lgr4 UTSW 2 109996682 missense probably damaging 0.98
R4912:Lgr4 UTSW 2 110006502 critical splice acceptor site probably null
R4994:Lgr4 UTSW 2 110011938 missense probably damaging 0.99
R5106:Lgr4 UTSW 2 109997595 missense probably damaging 0.97
R5131:Lgr4 UTSW 2 110012333 missense probably benign
R5152:Lgr4 UTSW 2 110000603 missense probably damaging 1.00
R5753:Lgr4 UTSW 2 110002512 nonsense probably null
R5860:Lgr4 UTSW 2 109991151 missense probably damaging 0.96
R5914:Lgr4 UTSW 2 109918272 missense possibly damaging 0.78
R6145:Lgr4 UTSW 2 110007243 nonsense probably null
R6263:Lgr4 UTSW 2 110011898 missense possibly damaging 0.95
R6400:Lgr4 UTSW 2 109991133 missense probably damaging 0.98
X0053:Lgr4 UTSW 2 110011437 missense possibly damaging 0.52
Predicted Primers PCR Primer
(F):5'- CTGCTATCCAAGGACATTGGGAACC -3'
(R):5'- AGCCACGTTATCTGAAGATCGCAC -3'

Sequencing Primer
(F):5'- TCCTGCTGATACCTAAAAGGGG -3'
(R):5'- TCACTTGGACTAAGCTATCAGGAG -3'
Posted On2013-04-16