Incidental Mutation 'R2164:Ctc1'
ID235368
Institutional Source Beutler Lab
Gene Symbol Ctc1
Ensembl Gene ENSMUSG00000020898
Gene NameCTS telomere maintenance complex component 1
Synonyms
MMRRC Submission 040167-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R2164 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location69015911-69036473 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 69035615 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Valine at position 859 (A859V)
Ref Sequence ENSEMBL: ENSMUSP00000124702 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021278] [ENSMUST00000116359] [ENSMUST00000152979] [ENSMUST00000161455]
Predicted Effect probably benign
Transcript: ENSMUST00000021278
AA Change: A1105V

PolyPhen 2 Score 0.010 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000021278
Gene: ENSMUSG00000020898
AA Change: A1105V

DomainStartEndE-ValueType
Pfam:CTC1 60 1195 N/A PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000116359
AA Change: A1106V

PolyPhen 2 Score 0.012 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000112063
Gene: ENSMUSG00000020898
AA Change: A1106V

DomainStartEndE-ValueType
Pfam:CTC1 61 1196 N/A PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123871
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143404
Predicted Effect probably benign
Transcript: ENSMUST00000152979
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154126
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161271
Predicted Effect possibly damaging
Transcript: ENSMUST00000161455
AA Change: A859V

PolyPhen 2 Score 0.922 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000124702
Gene: ENSMUSG00000020898
AA Change: A859V

DomainStartEndE-ValueType
Pfam:CTC1 1 949 N/A PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162256
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a component of the CST complex. This complex plays an essential role in protecting telomeres from degradation. This protein also forms a heterodimer with the CST complex subunit STN1 to form the enzyme alpha accessory factor. This enzyme regulates DNA replication. Mutations in this gene are the cause of cerebroretinal microangiopathy with calcifications and cysts. Alternate splicing results in both coding and non-coding variants. [provided by RefSeq, Mar 2012]
PHENOTYPE: Mice homozygous for a targeted allele exhibit defective telomere replication that leads to stem cell exhaustion, bone marrow failure and premature death. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca6 CTGTAGGAAATCTTCAATGT CTGT 11: 110,210,193 probably null Het
Adcy8 C T 15: 64,920,934 G58S probably benign Het
Adgra2 T A 8: 27,114,204 L24* probably null Het
Ampd2 C A 3: 108,085,369 probably benign Het
Ankrd26 T G 6: 118,525,791 E806A probably damaging Het
Apol9b A G 15: 77,735,439 D145G probably benign Het
Ash1l T A 3: 88,985,419 M1535K probably benign Het
Atf6 A G 1: 170,794,735 M439T probably damaging Het
B3glct A T 5: 149,754,156 M417L probably damaging Het
Cep192 A T 18: 67,820,360 T483S probably damaging Het
Cep290 G A 10: 100,518,795 E914K probably damaging Het
Chst15 C T 7: 132,270,385 A56T probably damaging Het
Col27a1 A T 4: 63,225,424 T450S probably benign Het
Cpsf2 A G 12: 101,985,335 N177S probably damaging Het
Csmd3 CCTTTGCGCTT CCTT 15: 47,741,236 probably null Het
Dcakd A G 11: 102,997,357 Y134H possibly damaging Het
Dctn3 G T 4: 41,723,065 Y22* probably null Het
Dync2h1 T A 9: 7,124,797 D2025V probably damaging Het
Dync2li1 T C 17: 84,636,274 S92P probably damaging Het
Eml5 A G 12: 98,887,097 V81A probably damaging Het
Espl1 C T 15: 102,319,588 R1625C probably damaging Het
Fam181a T C 12: 103,316,526 V230A probably benign Het
Fam213b T G 4: 154,898,149 Y56S probably damaging Het
Fanci T A 7: 79,395,995 D28E probably benign Het
Fmn1 A G 2: 113,365,617 N554S unknown Het
Frem2 T C 3: 53,537,330 Y2460C probably damaging Het
Fscb G A 12: 64,473,793 P300S probably damaging Het
Gm28042 A G 2: 120,036,748 D438G probably benign Het
Map1b C T 13: 99,429,338 V2292M unknown Het
Nbas A G 12: 13,330,646 D635G possibly damaging Het
Ncapg2 A G 12: 116,450,475 probably null Het
Nrp2 A T 1: 62,744,355 E205V probably damaging Het
Pcdhb3 A T 18: 37,302,186 T402S possibly damaging Het
Phc1 T C 6: 122,322,337 N638D possibly damaging Het
Plcb1 A G 2: 135,346,330 N781S possibly damaging Het
Prkdc T A 16: 15,705,207 D1164E probably damaging Het
Proser2 T A 2: 6,100,695 R353W possibly damaging Het
Ptges T A 2: 30,892,696 T115S probably benign Het
Ptprk A T 10: 28,560,142 D833V probably damaging Het
Pum1 T A 4: 130,728,083 L173* probably null Het
Pum1 G T 4: 130,728,084 L269F probably damaging Het
Rasgrp4 A G 7: 29,139,045 Y106C probably damaging Het
Rbbp6 T A 7: 122,999,474 probably benign Het
Rdh1 A G 10: 127,760,172 T79A possibly damaging Het
Relb A C 7: 19,613,761 probably null Het
Rnf122 G A 8: 31,112,164 W6* probably null Het
Rnf31 A G 14: 55,592,537 E138G possibly damaging Het
Scaf8 G A 17: 3,197,210 R936Q probably damaging Het
Scube3 T A 17: 28,166,134 V686D possibly damaging Het
Snrnp27 A T 6: 86,676,214 C141S probably benign Het
Spns2 C T 11: 72,458,671 V252M possibly damaging Het
Tmem159 A G 7: 120,120,239 E157G possibly damaging Het
Tomm40l C T 1: 171,220,134 S220N probably damaging Het
Trim17 A G 11: 58,971,411 D423G probably damaging Het
Trpc6 A AT 9: 8,610,465 probably null Het
Uba5 A T 9: 104,060,243 M89K probably damaging Het
Vav2 T C 2: 27,273,706 D628G probably damaging Het
Vmn2r107 T C 17: 20,375,642 L819P probably damaging Het
Vmn2r25 A T 6: 123,839,559 D354E possibly damaging Het
Xrn1 A G 9: 96,006,820 E984G possibly damaging Het
Zbtb17 T C 4: 141,464,246 V223A probably benign Het
Zcchc11 G A 4: 108,503,029 R481Q possibly damaging Het
Zfp592 T C 7: 81,041,438 S1122P possibly damaging Het
Other mutations in Ctc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02005:Ctc1 APN 11 69031149 missense probably damaging 1.00
IGL02135:Ctc1 APN 11 69021163 missense probably benign 0.25
IGL02164:Ctc1 APN 11 69026096 missense probably damaging 0.99
IGL02337:Ctc1 APN 11 69026131 missense probably damaging 1.00
IGL03149:Ctc1 APN 11 69031161 missense possibly damaging 0.55
PIT4810001:Ctc1 UTSW 11 69022526 missense probably benign 0.38
R0295:Ctc1 UTSW 11 69030588 missense possibly damaging 0.75
R0320:Ctc1 UTSW 11 69033537 missense probably damaging 1.00
R0496:Ctc1 UTSW 11 69035507 missense probably damaging 1.00
R1497:Ctc1 UTSW 11 69022561 missense probably benign 0.00
R1607:Ctc1 UTSW 11 69036150 missense possibly damaging 0.82
R1623:Ctc1 UTSW 11 69021142 missense probably damaging 0.99
R1856:Ctc1 UTSW 11 69034658 missense probably damaging 1.00
R1876:Ctc1 UTSW 11 69031564 missense probably benign 0.24
R1967:Ctc1 UTSW 11 69027862 critical splice acceptor site probably null
R2348:Ctc1 UTSW 11 69026191 missense probably benign 0.43
R2428:Ctc1 UTSW 11 69027701 missense possibly damaging 0.51
R3964:Ctc1 UTSW 11 69031128 missense probably damaging 1.00
R3965:Ctc1 UTSW 11 69031128 missense probably damaging 1.00
R3966:Ctc1 UTSW 11 69031128 missense probably damaging 1.00
R4398:Ctc1 UTSW 11 69022871 missense probably damaging 1.00
R4508:Ctc1 UTSW 11 69016117 splice site probably null
R4605:Ctc1 UTSW 11 69029726 missense possibly damaging 0.86
R4976:Ctc1 UTSW 11 69027326 missense probably damaging 1.00
R4979:Ctc1 UTSW 11 69033502 missense probably damaging 1.00
R5268:Ctc1 UTSW 11 69029810 missense possibly damaging 0.67
R6023:Ctc1 UTSW 11 69022607 missense probably benign 0.00
R6053:Ctc1 UTSW 11 69027901 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- CGTCTGATGTCTACAGTAGCATG -3'
(R):5'- CATGGGTTTTGCTTGCAGAC -3'

Sequencing Primer
(F):5'- GGGTACACCTGTAATCCAAGCATTG -3'
(R):5'- TTTGCTTGCAGACTAGAAAGGG -3'
Posted On2014-10-01