Incidental Mutation 'R0200:Dhx35'
ID23539
Institutional Source Beutler Lab
Gene Symbol Dhx35
Ensembl Gene ENSMUSG00000027655
Gene NameDEAH (Asp-Glu-Ala-His) box polypeptide 35
Synonyms1200009D07Rik, Ddx35
MMRRC Submission 038457-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0200 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location158794807-158858214 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 158829623 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Leucine at position 325 (M325L)
Ref Sequence ENSEMBL: ENSMUSP00000105104 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029186] [ENSMUST00000109478] [ENSMUST00000156893]
Predicted Effect probably benign
Transcript: ENSMUST00000029186
AA Change: M325L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000029186
Gene: ENSMUSG00000027655
AA Change: M325L

DomainStartEndE-ValueType
DEXDc 55 248 1.17e-18 SMART
HELICc 299 398 8.76e-18 SMART
HA2 458 549 1.49e-27 SMART
Pfam:OB_NTP_bind 628 660 2.7e-10 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000109478
AA Change: M325L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000105104
Gene: ENSMUSG00000027655
AA Change: M325L

DomainStartEndE-ValueType
DEXDc 55 248 1.17e-18 SMART
HELICc 299 398 8.76e-18 SMART
HA2 458 549 1.49e-27 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145692
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146797
Predicted Effect probably benign
Transcript: ENSMUST00000156893
SMART Domains Protein: ENSMUSP00000119497
Gene: ENSMUSG00000027655

DomainStartEndE-ValueType
PDB:3LLM|B 7 115 1e-10 PDB
Blast:DEXDc 55 119 5e-37 BLAST
SCOP:d1jpna2 63 115 3e-10 SMART
PDB:3KX2|A 116 204 1e-10 PDB
Predicted Effect noncoding transcript
Transcript: ENSMUST00000157070
Coding Region Coverage
  • 1x: 98.8%
  • 3x: 97.8%
  • 10x: 94.7%
  • 20x: 86.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] DEAD box proteins characterized by the conserved motif Asp-Glu-Ala-Asp (DEAD), are putative RNA helicases. They are implicated in a number of cellular processes involving alteration of RNA secondary structure such as translation initiation, nuclear and mitochondrial splicing, and ribosome and spliceosome assembly. Based on their distribution patterns, some members of the DEAD box protein family are believed to be involved in embryogenesis, spermatogenesis, and cellular growth and division. The function of this gene product which is a member of this family, has not been determined. Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Jun 2010]
Allele List at MGI
Other mutations in this stock
Total: 86 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A730017C20Rik A G 18: 59,062,459 probably null Het
Aatf T C 11: 84,445,676 K466E probably damaging Het
Abcc3 T C 11: 94,355,074 D1245G probably damaging Het
Adam12 T C 7: 133,974,416 probably null Het
Akap11 A G 14: 78,510,753 V1398A probably benign Het
Ank1 T G 8: 23,096,812 L461R probably damaging Het
Ankfn1 T C 11: 89,441,966 S402G possibly damaging Het
Arhgef40 A C 14: 51,996,974 E911D probably damaging Het
Atp2b1 C T 10: 98,979,814 Q107* probably null Het
BC117090 T C 16: 36,323,024 probably null Het
Cacng3 T A 7: 122,671,785 C4* probably null Het
Ccdc129 T C 6: 55,897,956 L297P probably benign Het
Cds1 G A 5: 101,814,433 V305M probably damaging Het
Cecr2 T G 6: 120,761,797 F1162V probably damaging Het
Cfap70 A T 14: 20,448,563 Y19N probably damaging Het
Chrm5 A G 2: 112,480,720 V17A probably benign Het
Col20a1 T C 2: 181,000,438 I714T probably damaging Het
Cpeb2 T A 5: 43,261,776 M156K possibly damaging Het
Defb25 C A 2: 152,622,412 V71L probably benign Het
Dhx57 A T 17: 80,251,473 L1019H probably damaging Het
Dnah6 T A 6: 73,069,420 D3195V probably damaging Het
Dph5 A G 3: 115,928,703 S277G probably benign Het
Dpm1 C A 2: 168,223,155 probably null Het
Dsg1a A T 18: 20,340,938 M1023L probably benign Het
Egf A G 3: 129,706,233 Y252H probably benign Het
Egf A G 3: 129,737,549 S126P probably damaging Het
Enam T C 5: 88,493,027 W183R possibly damaging Het
Foxn1 T C 11: 78,361,040 Y455C probably damaging Het
Gm14085 T A 2: 122,527,447 *661R probably null Het
Iars A T 13: 49,726,202 D983V possibly damaging Het
Ikzf4 C A 10: 128,634,676 G325V probably damaging Het
Il1rl1 T A 1: 40,441,303 W31R possibly damaging Het
Ip6k3 C T 17: 27,145,025 D350N probably damaging Het
Irgc1 T C 7: 24,432,006 D462G probably benign Het
Jph3 A G 8: 121,784,833 E520G probably benign Het
Kcna2 T A 3: 107,105,160 D352E probably benign Het
Klk4 T A 7: 43,885,361 I248N probably damaging Het
Krtap16-1 T C 11: 99,985,297 Y427C probably damaging Het
Lgr4 A G 2: 109,970,690 probably null Het
Lhpp C T 7: 132,610,677 probably benign Het
Lypd3 T A 7: 24,640,231 V241D probably damaging Het
Lyz2 T A 10: 117,280,773 N57Y possibly damaging Het
Man1a A G 10: 54,074,498 V176A probably damaging Het
Mcm4 G A 16: 15,629,639 T487I probably benign Het
Mettl21c T A 1: 44,013,654 I68F probably damaging Het
Miip T A 4: 147,862,263 T313S probably damaging Het
Mog A T 17: 37,012,419 I209K probably damaging Het
Myo1c C A 11: 75,672,182 D997E probably benign Het
Npc1 T C 18: 12,219,204 Y146C probably damaging Het
Nploc4 A G 11: 120,413,681 L238P probably damaging Het
Olfr231 T C 1: 174,117,512 H168R probably benign Het
Olfr531 T C 7: 140,400,875 Y57C probably damaging Het
Olfr56 T A 11: 49,135,047 M285K probably damaging Het
Opa1 A G 16: 29,614,129 N544S probably benign Het
Pam C T 1: 97,894,401 probably null Het
Pdgfra T C 5: 75,163,777 Y98H probably damaging Het
Plcz1 C T 6: 139,990,733 R590H probably damaging Het
Plxdc1 T C 11: 97,934,012 Y339C probably damaging Het
Plxna1 T C 6: 89,323,593 N1583S probably damaging Het
Plxna4 C T 6: 32,197,088 V1191M probably damaging Het
Polk T A 13: 96,496,822 N238Y probably benign Het
Ptprq T C 10: 107,685,157 N718S probably benign Het
Rsrc1 A T 3: 67,180,861 H176L probably damaging Het
Sbno1 T C 5: 124,384,541 D1072G probably damaging Het
Scmh1 A G 4: 120,483,831 K238R probably damaging Het
Senp7 A G 16: 56,123,873 T187A possibly damaging Het
Slc12a4 T C 8: 105,951,617 R315G probably benign Het
Slc16a10 A G 10: 40,040,616 V430A probably benign Het
Slc26a7 T C 4: 14,621,317 D23G probably benign Het
Slc7a7 A G 14: 54,377,802 L246P probably damaging Het
Spata7 T A 12: 98,663,169 S332T probably benign Het
Spsb1 A G 4: 149,898,216 *274R probably null Het
Sspo T G 6: 48,486,415 V3767G probably null Het
Syt10 C A 15: 89,826,941 A130S probably benign Het
Tgm6 T A 2: 130,152,945 probably null Het
Them7 A C 2: 105,297,917 N81T probably damaging Het
Tinag C A 9: 76,951,935 A464S probably damaging Het
Tmem217 T G 17: 29,526,310 I149L probably benign Het
Trp53rkb T G 2: 166,795,683 D186E probably damaging Het
Vmn1r20 T C 6: 57,432,099 Y137H probably damaging Het
Vmn1r60 T A 7: 5,544,380 L240F probably benign Het
Vmn1r64 A G 7: 5,883,818 M242T probably benign Het
Xkr4 T C 1: 3,670,663 N229S probably benign Het
Zcchc2 T A 1: 106,004,123 L352M probably damaging Het
Zfp217 C T 2: 170,115,462 A539T probably benign Het
Zfp638 T C 6: 83,967,354 L1018P probably damaging Het
Other mutations in Dhx35
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00093:Dhx35 APN 2 158827916 missense probably damaging 1.00
IGL01942:Dhx35 APN 2 158831864 missense probably damaging 1.00
IGL02899:Dhx35 APN 2 158801450 missense probably damaging 1.00
IGL02927:Dhx35 APN 2 158820416 missense probably damaging 1.00
IGL03224:Dhx35 APN 2 158857132 utr 3 prime probably benign
R0112:Dhx35 UTSW 2 158840620 missense probably damaging 0.99
R0609:Dhx35 UTSW 2 158817415 missense possibly damaging 0.62
R0714:Dhx35 UTSW 2 158844183 missense probably benign
R0884:Dhx35 UTSW 2 158831711 missense probably damaging 0.97
R1775:Dhx35 UTSW 2 158806437 missense probably damaging 1.00
R1912:Dhx35 UTSW 2 158842307 missense probably damaging 0.96
R2136:Dhx35 UTSW 2 158831861 missense probably damaging 1.00
R4094:Dhx35 UTSW 2 158842356 missense probably damaging 1.00
R4364:Dhx35 UTSW 2 158842352 nonsense probably null
R4421:Dhx35 UTSW 2 158806401 missense probably damaging 1.00
R4565:Dhx35 UTSW 2 158849535 missense probably benign 0.01
R5517:Dhx35 UTSW 2 158834912 missense probably damaging 1.00
R5732:Dhx35 UTSW 2 158831785 missense probably damaging 0.99
R5979:Dhx35 UTSW 2 158842869 missense probably benign 0.29
R6054:Dhx35 UTSW 2 158818299 missense probably benign 0.00
R6405:Dhx35 UTSW 2 158794919 missense probably damaging 1.00
R6452:Dhx35 UTSW 2 158831687 missense probably damaging 1.00
R6519:Dhx35 UTSW 2 158831710 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- TGAAGGTGACCACAGCTAAAGCCC -3'
(R):5'- TGTGTCTACACTTACACACGAGTGC -3'

Sequencing Primer
(F):5'- GCTAAAGCCCCGTTCCAG -3'
(R):5'- ctctcacacacacacacaaatac -3'
Posted On2013-04-16