Incidental Mutation 'R2165:Adgre1'
ID235469
Institutional Source Beutler Lab
Gene Symbol Adgre1
Ensembl Gene ENSMUSG00000004730
Gene Nameadhesion G protein-coupled receptor E1
SynonymsEmr1, EGF-TM7, F4/80, DD7A5-7, TM7LN3, Ly71
MMRRC Submission 040168-MU
Accession Numbers

Ncbi RefSeq: NM_010130.4 ;MGI:106912

Is this an essential gene? Possibly non essential (E-score: 0.255) question?
Stock #R2165 (G1)
Quality Score225
Status Validated
Chromosome17
Chromosomal Location57358686-57483529 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 57419338 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Arginine at position 403 (L403R)
Ref Sequence ENSEMBL: ENSMUSP00000083971 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000004850] [ENSMUST00000086763]
Predicted Effect probably damaging
Transcript: ENSMUST00000004850
AA Change: L403R

PolyPhen 2 Score 0.966 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000004850
Gene: ENSMUSG00000004730
AA Change: L403R

DomainStartEndE-ValueType
low complexity region 19 32 N/A INTRINSIC
EGF 35 80 1.43e-1 SMART
EGF_CA 81 122 3.59e-7 SMART
EGF_CA 133 172 4.56e-9 SMART
EGF_CA 173 221 1.29e-8 SMART
EGF_CA 222 271 2.31e-10 SMART
EGF_CA 272 318 1.06e-9 SMART
EGF_CA 319 367 1.18e-7 SMART
GPS 591 641 2.57e-19 SMART
Pfam:7tm_2 644 885 2.1e-63 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000086763
AA Change: L403R

PolyPhen 2 Score 0.966 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000083971
Gene: ENSMUSG00000004730
AA Change: L403R

DomainStartEndE-ValueType
low complexity region 19 32 N/A INTRINSIC
EGF 35 80 1.43e-1 SMART
EGF_CA 81 122 3.59e-7 SMART
EGF_CA 133 172 4.56e-9 SMART
EGF_CA 173 221 1.29e-8 SMART
EGF_CA 222 271 2.31e-10 SMART
EGF_CA 272 318 1.06e-9 SMART
EGF_CA 319 367 1.18e-7 SMART
GPS 591 641 2.57e-19 SMART
Pfam:7tm_2 644 885 2.1e-63 PFAM
Meta Mutation Damage Score 0.0304 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.6%
  • 20x: 96.0%
Validation Efficiency 99% (71/72)
MGI Phenotype Strain: 3582333
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that has a domain resembling seven transmembrane G protein-coupled hormone receptors (7TM receptors) at its C-terminus. The N-terminus of the encoded protein has six EGF-like modules, separated from the transmembrane segments by a serine/threonine-rich domain, a feature reminiscent of mucin-like, single-span, integral membrane glycoproteins with adhesive properties. Multiple alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jan 2012]
PHENOTYPE: Homozygous null mice fail to develop peripheral tolerance after inoculation with antigen because of a lack of efferent regulatory T cell development. [provided by MGI curators]
Allele List at MGI

All alleles(4) : Targeted(3) Chemically induced(1)

Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca4 A G 3: 122,112,399 T806A possibly damaging Het
AF067061 A T 13: 120,264,097 Q99L probably damaging Het
Alox12 A T 11: 70,242,572 probably null Het
Ankib1 A T 5: 3,713,210 D506E possibly damaging Het
Ascc3 T G 10: 50,721,839 Y1268D probably damaging Het
Bik A G 15: 83,541,423 M42V probably benign Het
Bola1 A T 3: 96,197,201 S26T probably benign Het
Bub1 T C 2: 127,801,281 I1048V probably benign Het
Cad A G 5: 31,062,220 N621S probably damaging Het
Camkv C A 9: 107,945,600 N69K possibly damaging Het
Ccdc110 T C 8: 45,942,839 M589T probably benign Het
Ccdc154 T A 17: 25,170,890 V498E probably damaging Het
Ccr1l1 A G 9: 123,977,654 L252P probably damaging Het
Cdh1 T C 8: 106,664,321 C690R probably damaging Het
Cfap157 T G 2: 32,778,163 probably null Het
Cux2 A G 5: 121,887,477 S43P possibly damaging Het
Cyb5rl C T 4: 107,068,683 P21S probably damaging Het
Cyp51 T G 5: 4,086,594 Q400P probably damaging Het
Dnah7b T C 1: 46,097,992 probably benign Het
Ephb4 A G 5: 137,354,426 I90M probably benign Het
Fam13c A G 10: 70,542,693 N269S probably damaging Het
Fam83c T A 2: 155,831,524 Y248F possibly damaging Het
Fat2 A G 11: 55,303,716 F1166L probably benign Het
Fem1a A G 17: 56,257,686 N260D probably benign Het
Fnbp4 T A 2: 90,767,399 probably null Het
Fut9 T A 4: 25,619,733 *360Y probably null Het
Fut9 T A 4: 25,619,734 *360L probably null Het
Gm11639 G A 11: 104,751,862 V1104I possibly damaging Het
Gm3727 T A 14: 7,264,625 Q10L probably damaging Het
Gpat2 G A 2: 127,428,291 V75M probably damaging Het
Haspin A C 11: 73,136,630 N544K probably damaging Het
Havcr1 A G 11: 46,778,552 N286S probably benign Het
Lrp6 A C 6: 134,459,283 C1307G probably damaging Het
Lrrc2 A C 9: 110,979,577 H294P possibly damaging Het
Mon2 A C 10: 123,042,364 probably null Het
Mrc2 G A 11: 105,348,431 probably null Het
Mrgprb1 T C 7: 48,447,322 I281V probably benign Het
Muc4 A G 16: 32,750,476 E118G probably damaging Het
Nefh T C 11: 4,943,872 D394G probably damaging Het
Neurl4 A G 11: 69,903,221 T168A probably benign Het
Olfr347 T A 2: 36,734,701 C127S probably damaging Het
Olfr642 T C 7: 104,049,638 T239A probably benign Het
Olfr982 A G 9: 40,074,915 N207D possibly damaging Het
Olfr987 A T 2: 85,331,102 N265K probably benign Het
Oxsr1 A C 9: 119,294,432 M92R probably damaging Het
Pde8a T C 7: 81,295,768 probably null Het
Pex5l T A 3: 32,953,132 probably null Het
Pik3r4 T A 9: 105,672,785 M1025K probably benign Het
Plch1 C T 3: 63,698,482 E1325K probably benign Het
Plin2 A T 4: 86,668,432 V54E probably damaging Het
Pqlc3 G A 12: 16,989,839 L192F probably damaging Het
Prss47 A T 13: 65,045,073 I298N probably damaging Het
Prune2 A G 19: 17,120,182 R1017G probably benign Het
Psg19 T A 7: 18,796,986 Y81F possibly damaging Het
Ptch1 T G 13: 63,524,959 E944A probably benign Het
Rrnad1 A T 3: 87,927,053 probably null Het
Serpinb1a T C 13: 32,850,414 probably benign Het
Sh3pxd2a A T 19: 47,278,355 V265E probably damaging Het
Slc22a17 A T 14: 54,908,825 Y337* probably null Het
Slc25a27 A G 17: 43,657,772 V138A probably benign Het
Slc4a2 A G 5: 24,431,316 Y220C probably damaging Het
Stab1 A T 14: 31,168,435 S20T probably benign Het
Thsd1 G T 8: 22,238,522 probably benign Het
Tmem204 G A 17: 25,080,592 probably benign Het
Tom1l1 A G 11: 90,649,895 probably benign Het
Toporsl T A 4: 52,612,072 F655Y possibly damaging Het
Vmn2r98 A G 17: 19,081,291 K852E unknown Het
Wdpcp T G 11: 21,691,884 L174R probably damaging Het
Zbbx G A 3: 75,112,107 P99S probably damaging Het
Zfhx4 C T 3: 5,403,358 P2859S probably benign Het
Zfp600 A T 4: 146,196,918 R719* probably null Het
Zfp697 C A 3: 98,428,014 A365E unknown Het
Zfp957 A C 14: 79,213,613 S249A probably benign Het
Other mutations in Adgre1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00090:Adgre1 APN 17 57450055 missense probably benign 0.00
IGL00966:Adgre1 APN 17 57419335 missense probably benign 0.04
IGL01680:Adgre1 APN 17 57402620 missense unknown
IGL01724:Adgre1 APN 17 57444064 nonsense probably null
IGL02172:Adgre1 APN 17 57478879 missense probably damaging 1.00
IGL02260:Adgre1 APN 17 57447891 missense probably benign 0.01
IGL02272:Adgre1 APN 17 57450021 nonsense probably null
IGL02336:Adgre1 APN 17 57411024 nonsense probably null
IGL02346:Adgre1 APN 17 57443919 missense probably benign 0.15
IGL02398:Adgre1 APN 17 57402824 nonsense probably null
IGL02618:Adgre1 APN 17 57444021 missense possibly damaging 0.66
IGL02690:Adgre1 APN 17 57480921 missense probably damaging 1.00
IGL02936:Adgre1 APN 17 57478833 missense probably benign 0.26
IGL03112:Adgre1 APN 17 57448029 splice site probably null
IGL03350:Adgre1 APN 17 57401908 missense probably benign 0.16
F480 UTSW 17 57444063 missense probably damaging 1.00
lomax UTSW 17 57402811 missense unknown
Onion UTSW 17 57402841 nonsense probably null
Scallion UTSW 17 57401977 missense possibly damaging 0.90
R0049:Adgre1 UTSW 17 57402841 nonsense probably null
R0153:Adgre1 UTSW 17 57443939 missense possibly damaging 0.92
R0277:Adgre1 UTSW 17 57444060 missense probably benign 0.00
R0278:Adgre1 UTSW 17 57447872 missense probably benign 0.07
R0323:Adgre1 UTSW 17 57444060 missense probably benign 0.00
R0389:Adgre1 UTSW 17 57406839 missense possibly damaging 0.80
R0492:Adgre1 UTSW 17 57402742 missense unknown
R0621:Adgre1 UTSW 17 57441359 missense probably damaging 0.98
R0647:Adgre1 UTSW 17 57411003 missense probably damaging 1.00
R1310:Adgre1 UTSW 17 57447936 missense probably benign 0.00
R1601:Adgre1 UTSW 17 57441353 missense probably benign 0.01
R1689:Adgre1 UTSW 17 57449921 missense probably benign 0.31
R1708:Adgre1 UTSW 17 57401974 missense possibly damaging 0.93
R1796:Adgre1 UTSW 17 57441350 missense probably benign 0.43
R1839:Adgre1 UTSW 17 57441299 missense probably benign 0.00
R1860:Adgre1 UTSW 17 57441363 missense probably benign 0.00
R2219:Adgre1 UTSW 17 57401912 missense possibly damaging 0.92
R2519:Adgre1 UTSW 17 57410956 missense probably damaging 1.00
R3874:Adgre1 UTSW 17 57401925 missense probably benign 0.08
R3911:Adgre1 UTSW 17 57447860 missense probably damaging 1.00
R4190:Adgre1 UTSW 17 57402811 missense unknown
R4439:Adgre1 UTSW 17 57447954 missense probably damaging 1.00
R4513:Adgre1 UTSW 17 57410947 missense probably benign 0.34
R4529:Adgre1 UTSW 17 57420519 missense possibly damaging 0.92
R4543:Adgre1 UTSW 17 57406874 missense probably benign 0.07
R4610:Adgre1 UTSW 17 57450073 missense possibly damaging 0.50
R4665:Adgre1 UTSW 17 57480947 missense probably benign 0.20
R4911:Adgre1 UTSW 17 57447832 missense possibly damaging 0.57
R4928:Adgre1 UTSW 17 57444064 nonsense probably null
R4942:Adgre1 UTSW 17 57406903 missense probably damaging 1.00
R4946:Adgre1 UTSW 17 57443918 missense probably benign 0.33
R4953:Adgre1 UTSW 17 57441321 missense probably damaging 0.99
R5107:Adgre1 UTSW 17 57401977 missense possibly damaging 0.90
R5366:Adgre1 UTSW 17 57402817 missense probably benign 0.39
R5590:Adgre1 UTSW 17 57445034 missense probably damaging 1.00
R5619:Adgre1 UTSW 17 57420437 missense probably benign 0.15
R5699:Adgre1 UTSW 17 57481007 missense probably benign 0.43
R5734:Adgre1 UTSW 17 57443990 missense probably benign 0.00
R5860:Adgre1 UTSW 17 57445034 missense probably damaging 1.00
R6039:Adgre1 UTSW 17 57406859 missense probably benign 0.28
R6039:Adgre1 UTSW 17 57406859 missense probably benign 0.28
R6149:Adgre1 UTSW 17 57445018 missense probably benign 0.08
R6478:Adgre1 UTSW 17 57401955 missense possibly damaging 0.81
R6709:Adgre1 UTSW 17 57406917 missense probably benign 0.10
R6864:Adgre1 UTSW 17 57478879 missense probably damaging 1.00
R6945:Adgre1 UTSW 17 57410844 missense probably benign 0.01
R6945:Adgre1 UTSW 17 57420399 missense probably benign 0.39
R6988:Adgre1 UTSW 17 57408445 missense probably benign 0.00
R7019:Adgre1 UTSW 17 57410945 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- TGTTATCTGCCACCCAGCTT -3'
(R):5'- TGAAGCAAAAGAAGACGCTACT -3'

Sequencing Primer
(F):5'- CCCAGCTTCTCTGAAATGAGG -3'
(R):5'- GGTCTTGCAAACTTTATATGCCTCAG -3'
Posted On2014-10-01