Incidental Mutation 'R2165:Prune2'
ID235471
Institutional Source Beutler Lab
Gene Symbol Prune2
Ensembl Gene ENSMUSG00000039126
Gene Nameprune homolog 2
SynonymsA230083H22Rik, 6330414G02Rik, A330102H22Rik
MMRRC Submission 040168-MU
Accession Numbers

Genbank: NM_181348

Is this an essential gene? Probably non essential (E-score: 0.085) question?
Stock #R2165 (G1)
Quality Score225
Status Validated
Chromosome19
Chromosomal Location16956118-17223932 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 17120182 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Glycine at position 1017 (R1017G)
Ref Sequence ENSEMBL: ENSMUSP00000084977 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000087689]
Predicted Effect probably benign
Transcript: ENSMUST00000087689
AA Change: R1017G

PolyPhen 2 Score 0.185 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000084977
Gene: ENSMUSG00000039126
AA Change: R1017G

DomainStartEndE-ValueType
DHHA2 208 351 8.32e-17 SMART
low complexity region 433 445 N/A INTRINSIC
low complexity region 476 488 N/A INTRINSIC
low complexity region 547 553 N/A INTRINSIC
low complexity region 962 975 N/A INTRINSIC
low complexity region 1071 1082 N/A INTRINSIC
low complexity region 1368 1378 N/A INTRINSIC
low complexity region 1533 1545 N/A INTRINSIC
low complexity region 1668 1685 N/A INTRINSIC
low complexity region 1740 1751 N/A INTRINSIC
low complexity region 2162 2175 N/A INTRINSIC
low complexity region 2222 2233 N/A INTRINSIC
low complexity region 2591 2606 N/A INTRINSIC
low complexity region 2731 2744 N/A INTRINSIC
SEC14 2882 3037 2.08e-12 SMART
Meta Mutation Damage Score 0.108 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.6%
  • 20x: 96.0%
Validation Efficiency 99% (71/72)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the B-cell CLL/lymphoma 2 and adenovirus E1B 19 kDa interacting family, whose members play roles in many cellular processes including apotosis, cell transformation, and synaptic function. Several functions for this protein have been demonstrated including suppression of Ras homolog family member A activity, which results in reduced stress fiber formation and suppression of oncogenic cellular transformation. A high molecular weight isoform of this protein has also been shown to colocalize with Adaptor protein complex 2, beta-Adaptin and endodermal markers, suggesting an involvement in post-endocytic trafficking. In prostate cancer cells, this gene acts as a tumor suppressor and its expression is regulated by prostate cancer antigen 3, a non-protein coding gene on the opposite DNA strand in an intron of this gene. Prostate cancer antigen 3 regulates levels of this gene through formation of a double-stranded RNA that undergoes adenosine deaminase actin on RNA-dependent adenosine-to-inosine RNA editing. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2015]
Allele List at MGI

All alleles(160) : Gene trapped(160)

Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca4 A G 3: 122,112,399 T806A possibly damaging Het
Adgre1 T G 17: 57,419,338 L403R probably damaging Het
AF067061 A T 13: 120,264,097 Q99L probably damaging Het
Alox12 A T 11: 70,242,572 probably null Het
Ankib1 A T 5: 3,713,210 D506E possibly damaging Het
Ascc3 T G 10: 50,721,839 Y1268D probably damaging Het
Bik A G 15: 83,541,423 M42V probably benign Het
Bola1 A T 3: 96,197,201 S26T probably benign Het
Bub1 T C 2: 127,801,281 I1048V probably benign Het
Cad A G 5: 31,062,220 N621S probably damaging Het
Camkv C A 9: 107,945,600 N69K possibly damaging Het
Ccdc110 T C 8: 45,942,839 M589T probably benign Het
Ccdc154 T A 17: 25,170,890 V498E probably damaging Het
Ccr1l1 A G 9: 123,977,654 L252P probably damaging Het
Cdh1 T C 8: 106,664,321 C690R probably damaging Het
Cfap157 T G 2: 32,778,163 probably null Het
Cux2 A G 5: 121,887,477 S43P possibly damaging Het
Cyb5rl C T 4: 107,068,683 P21S probably damaging Het
Cyp51 T G 5: 4,086,594 Q400P probably damaging Het
Dnah7b T C 1: 46,097,992 probably benign Het
Ephb4 A G 5: 137,354,426 I90M probably benign Het
Fam13c A G 10: 70,542,693 N269S probably damaging Het
Fam83c T A 2: 155,831,524 Y248F possibly damaging Het
Fat2 A G 11: 55,303,716 F1166L probably benign Het
Fem1a A G 17: 56,257,686 N260D probably benign Het
Fnbp4 T A 2: 90,767,399 probably null Het
Fut9 T A 4: 25,619,733 *360Y probably null Het
Fut9 T A 4: 25,619,734 *360L probably null Het
Gm11639 G A 11: 104,751,862 V1104I possibly damaging Het
Gm3727 T A 14: 7,264,625 Q10L probably damaging Het
Gpat2 G A 2: 127,428,291 V75M probably damaging Het
Haspin A C 11: 73,136,630 N544K probably damaging Het
Havcr1 A G 11: 46,778,552 N286S probably benign Het
Lrp6 A C 6: 134,459,283 C1307G probably damaging Het
Lrrc2 A C 9: 110,979,577 H294P possibly damaging Het
Mon2 A C 10: 123,042,364 probably null Het
Mrc2 G A 11: 105,348,431 probably null Het
Mrgprb1 T C 7: 48,447,322 I281V probably benign Het
Muc4 A G 16: 32,750,476 E118G probably damaging Het
Nefh T C 11: 4,943,872 D394G probably damaging Het
Neurl4 A G 11: 69,903,221 T168A probably benign Het
Olfr347 T A 2: 36,734,701 C127S probably damaging Het
Olfr642 T C 7: 104,049,638 T239A probably benign Het
Olfr982 A G 9: 40,074,915 N207D possibly damaging Het
Olfr987 A T 2: 85,331,102 N265K probably benign Het
Oxsr1 A C 9: 119,294,432 M92R probably damaging Het
Pde8a T C 7: 81,295,768 probably null Het
Pex5l T A 3: 32,953,132 probably null Het
Pik3r4 T A 9: 105,672,785 M1025K probably benign Het
Plch1 C T 3: 63,698,482 E1325K probably benign Het
Plin2 A T 4: 86,668,432 V54E probably damaging Het
Pqlc3 G A 12: 16,989,839 L192F probably damaging Het
Prss47 A T 13: 65,045,073 I298N probably damaging Het
Psg19 T A 7: 18,796,986 Y81F possibly damaging Het
Ptch1 T G 13: 63,524,959 E944A probably benign Het
Rrnad1 A T 3: 87,927,053 probably null Het
Serpinb1a T C 13: 32,850,414 probably benign Het
Sh3pxd2a A T 19: 47,278,355 V265E probably damaging Het
Slc22a17 A T 14: 54,908,825 Y337* probably null Het
Slc25a27 A G 17: 43,657,772 V138A probably benign Het
Slc4a2 A G 5: 24,431,316 Y220C probably damaging Het
Stab1 A T 14: 31,168,435 S20T probably benign Het
Thsd1 G T 8: 22,238,522 probably benign Het
Tmem204 G A 17: 25,080,592 probably benign Het
Tom1l1 A G 11: 90,649,895 probably benign Het
Toporsl T A 4: 52,612,072 F655Y possibly damaging Het
Vmn2r98 A G 17: 19,081,291 K852E unknown Het
Wdpcp T G 11: 21,691,884 L174R probably damaging Het
Zbbx G A 3: 75,112,107 P99S probably damaging Het
Zfhx4 C T 3: 5,403,358 P2859S probably benign Het
Zfp600 A T 4: 146,196,918 R719* probably null Het
Zfp697 C A 3: 98,428,014 A365E unknown Het
Zfp957 A C 14: 79,213,613 S249A probably benign Het
Other mutations in Prune2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00234:Prune2 APN 19 17168344 critical splice donor site probably null
IGL00848:Prune2 APN 19 17119118 missense probably damaging 1.00
IGL00862:Prune2 APN 19 17119349 missense probably benign 0.41
IGL00915:Prune2 APN 19 17016253 missense probably damaging 1.00
IGL01084:Prune2 APN 19 17118209 missense probably benign 0.19
IGL01109:Prune2 APN 19 17123879 missense probably benign 0.03
IGL01372:Prune2 APN 19 17125069 missense probably damaging 1.00
IGL01650:Prune2 APN 19 17168292 missense possibly damaging 0.95
IGL01752:Prune2 APN 19 17123903 missense possibly damaging 0.50
IGL01812:Prune2 APN 19 17003777 missense possibly damaging 0.50
IGL01902:Prune2 APN 19 17118638 missense probably benign 0.00
IGL02195:Prune2 APN 19 17119557 missense probably benign 0.00
IGL02502:Prune2 APN 19 17123881 missense probably benign 0.00
IGL02569:Prune2 APN 19 17178859 missense probably damaging 0.99
IGL02693:Prune2 APN 19 17124491 missense probably benign 0.03
IGL02737:Prune2 APN 19 17193411 nonsense probably null
IGL02794:Prune2 APN 19 17119361 missense probably benign 0.19
IGL02985:Prune2 APN 19 17016359 critical splice donor site probably null
IGL03349:Prune2 APN 19 17123346 missense probably damaging 1.00
3-1:Prune2 UTSW 19 17125282 missense probably benign 0.00
R0060:Prune2 UTSW 19 17003733 missense probably damaging 1.00
R0098:Prune2 UTSW 19 17123903 missense possibly damaging 0.50
R0098:Prune2 UTSW 19 17123903 missense possibly damaging 0.50
R0165:Prune2 UTSW 19 17122610 missense probably benign 0.00
R0277:Prune2 UTSW 19 17121389 missense probably damaging 0.99
R0321:Prune2 UTSW 19 17120927 missense possibly damaging 0.78
R0321:Prune2 UTSW 19 17122454 missense probably benign 0.39
R0374:Prune2 UTSW 19 17120910 missense probably benign 0.00
R0380:Prune2 UTSW 19 17124007 missense probably damaging 1.00
R0396:Prune2 UTSW 19 17123080 missense probably benign 0.35
R0408:Prune2 UTSW 19 17122310 missense probably benign 0.00
R0421:Prune2 UTSW 19 17123311 missense probably benign 0.02
R0480:Prune2 UTSW 19 17006792 splice site probably benign
R0531:Prune2 UTSW 19 17006753 missense probably damaging 1.00
R0546:Prune2 UTSW 19 17020666 splice site probably benign
R0554:Prune2 UTSW 19 17125218 nonsense probably null
R0659:Prune2 UTSW 19 17122835 missense probably damaging 1.00
R0699:Prune2 UTSW 19 17123955 missense probably damaging 1.00
R0781:Prune2 UTSW 19 17125222 missense probably benign
R1110:Prune2 UTSW 19 17125222 missense probably benign
R1178:Prune2 UTSW 19 17123105 missense probably benign 0.22
R1181:Prune2 UTSW 19 17123105 missense probably benign 0.22
R1337:Prune2 UTSW 19 17119607 missense possibly damaging 0.70
R1356:Prune2 UTSW 19 17212317 missense probably benign 0.40
R1385:Prune2 UTSW 19 17124948 missense possibly damaging 0.50
R1659:Prune2 UTSW 19 17120651 missense possibly damaging 0.59
R1738:Prune2 UTSW 19 17125010 missense probably benign 0.01
R1756:Prune2 UTSW 19 17123704 missense probably benign 0.01
R1765:Prune2 UTSW 19 17125598 missense probably damaging 1.00
R1782:Prune2 UTSW 19 17122173 missense probably benign 0.00
R1817:Prune2 UTSW 19 17122081 missense probably benign 0.00
R1838:Prune2 UTSW 19 17199878 missense probably damaging 1.00
R1851:Prune2 UTSW 19 17199139 missense probably damaging 1.00
R1852:Prune2 UTSW 19 17199139 missense probably damaging 1.00
R1866:Prune2 UTSW 19 17123492 missense probably damaging 1.00
R1911:Prune2 UTSW 19 17113674 missense probably benign 0.02
R1983:Prune2 UTSW 19 17020642 missense probably damaging 0.97
R2014:Prune2 UTSW 19 17120523 missense probably damaging 1.00
R2066:Prune2 UTSW 19 17120678 missense possibly damaging 0.57
R2088:Prune2 UTSW 19 17119745 missense possibly damaging 0.95
R2111:Prune2 UTSW 19 17208238 missense probably damaging 1.00
R2128:Prune2 UTSW 19 17122422 missense probably benign 0.00
R2241:Prune2 UTSW 19 17123092 missense probably damaging 0.96
R2278:Prune2 UTSW 19 17118555 missense possibly damaging 0.93
R2504:Prune2 UTSW 19 17000036 missense probably damaging 1.00
R2508:Prune2 UTSW 19 17122622 missense probably benign 0.43
R3055:Prune2 UTSW 19 17125043 missense probably damaging 0.98
R3086:Prune2 UTSW 19 17121413 missense possibly damaging 0.75
R3104:Prune2 UTSW 19 17119156 missense probably damaging 1.00
R3105:Prune2 UTSW 19 17119156 missense probably damaging 1.00
R3547:Prune2 UTSW 19 17124348 missense probably damaging 0.96
R3702:Prune2 UTSW 19 17178871 missense probably damaging 1.00
R3753:Prune2 UTSW 19 17125454 missense probably benign 0.38
R3933:Prune2 UTSW 19 17123954 missense probably damaging 1.00
R3935:Prune2 UTSW 19 17199786 missense probably damaging 1.00
R4022:Prune2 UTSW 19 17000020 missense probably damaging 1.00
R4042:Prune2 UTSW 19 17003826 critical splice donor site probably null
R4164:Prune2 UTSW 19 17003734 missense possibly damaging 0.87
R4453:Prune2 UTSW 19 17121910 missense probably benign 0.00
R4642:Prune2 UTSW 19 17020655 critical splice donor site probably null
R4661:Prune2 UTSW 19 17000023 missense probably damaging 1.00
R4666:Prune2 UTSW 19 17120188 nonsense probably null
R4823:Prune2 UTSW 19 17120504 missense probably damaging 1.00
R4897:Prune2 UTSW 19 17121855 missense probably benign 0.03
R4922:Prune2 UTSW 19 17122752 missense probably benign 0.00
R4962:Prune2 UTSW 19 17122273 missense probably benign 0.11
R5026:Prune2 UTSW 19 17199142 missense probably damaging 1.00
R5042:Prune2 UTSW 19 17119797 missense possibly damaging 0.94
R5124:Prune2 UTSW 19 17199910 missense probably damaging 1.00
R5133:Prune2 UTSW 19 17003631 missense probably damaging 1.00
R5184:Prune2 UTSW 19 17216357 missense possibly damaging 0.95
R5234:Prune2 UTSW 19 17118668 missense probably damaging 1.00
R5339:Prune2 UTSW 19 17120872 missense probably damaging 1.00
R5363:Prune2 UTSW 19 17118266 missense probably damaging 1.00
R5382:Prune2 UTSW 19 17003659 missense probably damaging 1.00
R5436:Prune2 UTSW 19 17020643 missense probably damaging 1.00
R5480:Prune2 UTSW 19 17120947 missense possibly damaging 0.66
R5635:Prune2 UTSW 19 17118209 missense probably benign 0.19
R5678:Prune2 UTSW 19 17118668 missense probably damaging 1.00
R5814:Prune2 UTSW 19 17016361 splice site probably null
R5894:Prune2 UTSW 19 17121391 missense possibly damaging 0.88
R6011:Prune2 UTSW 19 17118716 missense probably benign 0.35
R6207:Prune2 UTSW 19 17118116 missense probably damaging 1.00
R6218:Prune2 UTSW 19 17121562 missense probably benign 0.00
R6573:Prune2 UTSW 19 17121157 missense probably damaging 1.00
R6573:Prune2 UTSW 19 17121158 missense possibly damaging 0.61
R6734:Prune2 UTSW 19 17003733 missense probably damaging 1.00
R6805:Prune2 UTSW 19 17120590 missense probably benign
R6837:Prune2 UTSW 19 17178928 missense probably damaging 1.00
R6850:Prune2 UTSW 19 17122188 missense probably benign 0.00
R6858:Prune2 UTSW 19 17118106 missense possibly damaging 0.70
R6874:Prune2 UTSW 19 17123228 missense probably damaging 1.00
R6954:Prune2 UTSW 19 17000021 missense probably damaging 1.00
R7098:Prune2 UTSW 19 17120602 missense not run
R7102:Prune2 UTSW 19 17121213 missense not run
X0019:Prune2 UTSW 19 17121517 missense probably benign 0.16
X0028:Prune2 UTSW 19 17122885 missense probably damaging 1.00
X0064:Prune2 UTSW 19 17122375 missense probably damaging 1.00
X0066:Prune2 UTSW 19 17118790 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGAGAAGATTCAGTCCCATCTCC -3'
(R):5'- TACAGTCGCATCATGCTAGG -3'

Sequencing Primer
(F):5'- GAAGATTCAGTCCCATCTCCATTAG -3'
(R):5'- GCATCATGCTAGGGTCATCGTAAC -3'
Posted On2014-10-01