Incidental Mutation 'R2166:Gpr1'
ID235476
Institutional Source Beutler Lab
Gene Symbol Gpr1
Ensembl Gene ENSMUSG00000046856
Gene NameG protein-coupled receptor 1
Synonyms
MMRRC Submission 040169-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2166 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location63182691-63214543 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 63183948 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 43 (F43L)
Ref Sequence ENSEMBL: ENSMUSP00000051417 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027108] [ENSMUST00000050536] [ENSMUST00000129339] [ENSMUST00000135877] [ENSMUST00000142062] [ENSMUST00000188524]
Predicted Effect probably benign
Transcript: ENSMUST00000027108
Predicted Effect probably benign
Transcript: ENSMUST00000050536
AA Change: F43L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000051417
Gene: ENSMUSG00000046856
AA Change: F43L

DomainStartEndE-ValueType
Pfam:7tm_1 55 302 3.9e-40 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000082668
Predicted Effect probably benign
Transcript: ENSMUST00000129339
SMART Domains Protein: ENSMUSP00000116492
Gene: ENSMUSG00000025967

DomainStartEndE-ValueType
EF-1_beta_acid 103 130 2.53e-4 SMART
EF1_GNE 139 225 3.86e-44 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000135877
SMART Domains Protein: ENSMUSP00000137671
Gene: ENSMUSG00000025967

DomainStartEndE-ValueType
transmembrane domain 38 57 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000142062
Predicted Effect probably benign
Transcript: ENSMUST00000188524
SMART Domains Protein: ENSMUSP00000140895
Gene: ENSMUSG00000025967

DomainStartEndE-ValueType
EF-1_beta_acid 62 89 1.2e-8 SMART
EF1_GNE 98 184 2.9e-48 SMART
Meta Mutation Damage Score 0.1152 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.5%
  • 20x: 95.7%
Validation Efficiency 100% (42/42)
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrv1 A T 13: 81,568,643 F779I probably damaging Het
Arsi G A 18: 60,916,651 G202E probably benign Het
Birc6 A T 17: 74,635,795 T2761S probably benign Het
Cav1 A T 6: 17,339,431 I141F possibly damaging Het
Gm973 A G 1: 59,526,739 D39G possibly damaging Het
Gucy1a2 T A 9: 3,579,513 probably null Het
Il1b A T 2: 129,365,048 M264K probably damaging Het
Itpr1 A G 6: 108,388,225 Y38C probably damaging Het
Kcnb2 A C 1: 15,711,316 D804A possibly damaging Het
Kcnt1 T A 2: 25,891,183 probably benign Het
Krt6b T C 15: 101,678,615 probably null Het
Mef2a A G 7: 67,266,122 V144A probably damaging Het
Mroh3 A G 1: 136,186,053 M666T probably benign Het
Mslnl G A 17: 25,742,934 V128M probably damaging Het
Nalcn T A 14: 123,369,951 Y702F probably benign Het
Napepld T A 5: 21,683,232 K73I possibly damaging Het
Olfr191 T A 16: 59,085,586 K299I probably benign Het
Olfr935 G A 9: 38,995,217 Q73* probably null Het
Pappa A C 4: 65,156,445 D412A probably damaging Het
Plbd1 A G 6: 136,613,790 probably null Het
Ppp1r10 G T 17: 35,930,589 R752L unknown Het
Prep T C 10: 45,092,655 probably benign Het
Ptch1 T G 13: 63,524,959 E944A probably benign Het
Ptprz1 A G 6: 23,045,633 N2134S possibly damaging Het
Rhbdl3 A G 11: 80,319,697 Y92C probably damaging Het
Rtkn2 T C 10: 68,041,696 S532P possibly damaging Het
Rtl1 T A 12: 109,590,554 H1617L probably damaging Het
Skint6 T A 4: 112,854,452 N956I probably benign Het
Slc13a2 A G 11: 78,403,075 V287A probably benign Het
Slc9a2 A G 1: 40,742,768 K386E probably damaging Het
Spata20 G A 11: 94,479,104 H789Y probably benign Het
Stk19 A G 17: 34,832,510 I23T possibly damaging Het
Tonsl A G 15: 76,637,313 I293T probably benign Het
Topbp1 A G 9: 103,312,929 probably null Het
Trappc2l T A 8: 122,613,162 S44T probably benign Het
Tsr1 A G 11: 74,907,454 probably null Het
Ugdh A G 5: 65,417,014 probably benign Het
Unc119 A G 11: 78,347,335 probably null Het
Zkscan14 G A 5: 145,196,134 P196S probably benign Het
Zmat4 T C 8: 23,902,136 L36P probably damaging Het
Other mutations in Gpr1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00427:Gpr1 APN 1 63183338 missense probably damaging 0.99
IGL01086:Gpr1 APN 1 63183491 missense probably benign 0.01
IGL01490:Gpr1 APN 1 63183296 missense probably damaging 0.99
IGL02409:Gpr1 APN 1 63183716 missense probably damaging 1.00
IGL02426:Gpr1 APN 1 63183668 missense probably damaging 0.97
R0218:Gpr1 UTSW 1 63183531 missense probably benign 0.25
R2088:Gpr1 UTSW 1 63183652 unclassified probably null
R2895:Gpr1 UTSW 1 63183162 missense probably benign 0.24
R2896:Gpr1 UTSW 1 63183162 missense probably benign 0.24
R5102:Gpr1 UTSW 1 63183167 missense probably damaging 0.99
R5131:Gpr1 UTSW 1 63183681 missense probably damaging 1.00
R5471:Gpr1 UTSW 1 63183899 missense probably damaging 1.00
R5652:Gpr1 UTSW 1 63183467 missense probably benign 0.00
R6187:Gpr1 UTSW 1 63183275 missense probably damaging 1.00
X0060:Gpr1 UTSW 1 63183059 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- CAAGGCCACGTAGGAAATGTAC -3'
(R):5'- GCAAGCCCTTCTAAAATCGTC -3'

Sequencing Primer
(F):5'- CCACGTAGGAAATGTACAGGGG -3'
(R):5'- GCCCTTCTAAAATCGTCATAAAATGG -3'
Posted On2014-10-01