Incidental Mutation 'R2166:Prep'
ID235498
Institutional Source Beutler Lab
Gene Symbol Prep
Ensembl Gene ENSMUSG00000019849
Gene Nameprolyl endopeptidase
Synonymsprolyl oligopeptidase, Pop, D10Wsu136e
MMRRC Submission 040169-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R2166 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location45067203-45167198 bp(+) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) T to C at 45092655 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000097444 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099858]
Predicted Effect probably benign
Transcript: ENSMUST00000099858
SMART Domains Protein: ENSMUSP00000097444
Gene: ENSMUSG00000019849

DomainStartEndE-ValueType
Pfam:Peptidase_S9_N 7 423 1.2e-170 PFAM
Pfam:Peptidase_S9 482 707 1.7e-72 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000103894
Meta Mutation Damage Score 0.1032 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.5%
  • 20x: 95.7%
Validation Efficiency 100% (42/42)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a cytosolic prolyl endopeptidase that cleaves peptide bonds on the C-terminal side of prolyl residues within peptides that are up to approximately 30 amino acids long. Prolyl endopeptidases have been reported to be involved in the maturation and degradation of peptide hormones and neuropeptides. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a gene trap allele exhibit sex-dependent resistance to diet-induced obesity and adiposity. Mice heterozygous for a gene trap allele exhibit maternal inheritance influenced increase in body weight, organ weight, and adiposity. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrv1 A T 13: 81,568,643 F779I probably damaging Het
Arsi G A 18: 60,916,651 G202E probably benign Het
Birc6 A T 17: 74,635,795 T2761S probably benign Het
Cav1 A T 6: 17,339,431 I141F possibly damaging Het
Gm973 A G 1: 59,526,739 D39G possibly damaging Het
Gpr1 A G 1: 63,183,948 F43L probably benign Het
Gucy1a2 T A 9: 3,579,513 probably null Het
Il1b A T 2: 129,365,048 M264K probably damaging Het
Itpr1 A G 6: 108,388,225 Y38C probably damaging Het
Kcnb2 A C 1: 15,711,316 D804A possibly damaging Het
Kcnt1 T A 2: 25,891,183 probably benign Het
Krt6b T C 15: 101,678,615 probably null Het
Mef2a A G 7: 67,266,122 V144A probably damaging Het
Mroh3 A G 1: 136,186,053 M666T probably benign Het
Mslnl G A 17: 25,742,934 V128M probably damaging Het
Nalcn T A 14: 123,369,951 Y702F probably benign Het
Napepld T A 5: 21,683,232 K73I possibly damaging Het
Olfr191 T A 16: 59,085,586 K299I probably benign Het
Olfr935 G A 9: 38,995,217 Q73* probably null Het
Pappa A C 4: 65,156,445 D412A probably damaging Het
Plbd1 A G 6: 136,613,790 probably null Het
Ppp1r10 G T 17: 35,930,589 R752L unknown Het
Ptch1 T G 13: 63,524,959 E944A probably benign Het
Ptprz1 A G 6: 23,045,633 N2134S possibly damaging Het
Rhbdl3 A G 11: 80,319,697 Y92C probably damaging Het
Rtkn2 T C 10: 68,041,696 S532P possibly damaging Het
Rtl1 T A 12: 109,590,554 H1617L probably damaging Het
Skint6 T A 4: 112,854,452 N956I probably benign Het
Slc13a2 A G 11: 78,403,075 V287A probably benign Het
Slc9a2 A G 1: 40,742,768 K386E probably damaging Het
Spata20 G A 11: 94,479,104 H789Y probably benign Het
Stk19 A G 17: 34,832,510 I23T possibly damaging Het
Tonsl A G 15: 76,637,313 I293T probably benign Het
Topbp1 A G 9: 103,312,929 probably null Het
Trappc2l T A 8: 122,613,162 S44T probably benign Het
Tsr1 A G 11: 74,907,454 probably null Het
Ugdh A G 5: 65,417,014 probably benign Het
Unc119 A G 11: 78,347,335 probably null Het
Zkscan14 G A 5: 145,196,134 P196S probably benign Het
Zmat4 T C 8: 23,902,136 L36P probably damaging Het
Other mutations in Prep
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00654:Prep APN 10 45115173 missense probably damaging 1.00
IGL01412:Prep APN 10 45153112 missense probably damaging 1.00
IGL01577:Prep APN 10 45072048 splice site probably benign
IGL02751:Prep APN 10 45115186 missense probably damaging 1.00
IGL02754:Prep APN 10 45067332 start codon destroyed probably null 0.23
IGL02875:Prep APN 10 45158433 missense probably damaging 1.00
IGL02957:Prep APN 10 45126030 missense probably benign 0.44
R0008:Prep UTSW 10 45115078 missense probably benign 0.17
R0008:Prep UTSW 10 45115078 missense probably benign 0.17
R0167:Prep UTSW 10 45158230 critical splice acceptor site probably null
R0396:Prep UTSW 10 45092676 missense probably damaging 1.00
R0828:Prep UTSW 10 45155525 missense probably benign 0.01
R1309:Prep UTSW 10 45126026 missense probably benign
R4020:Prep UTSW 10 45092798 splice site probably benign
R4058:Prep UTSW 10 45158371 missense probably benign 0.29
R4162:Prep UTSW 10 45067362 missense possibly damaging 0.96
R4163:Prep UTSW 10 45067340 missense probably benign
R4163:Prep UTSW 10 45067362 missense possibly damaging 0.96
R4328:Prep UTSW 10 45120649 missense probably benign
R4343:Prep UTSW 10 45120770 missense probably damaging 0.99
R4493:Prep UTSW 10 45120819 missense probably benign 0.38
R4495:Prep UTSW 10 45120819 missense probably benign 0.38
R5192:Prep UTSW 10 45153111 missense probably benign 0.28
R5569:Prep UTSW 10 45097437 missense probably benign
R5888:Prep UTSW 10 45067364 missense possibly damaging 0.74
R5999:Prep UTSW 10 45072129 critical splice donor site probably null
R6468:Prep UTSW 10 45115107 missense probably damaging 1.00
R6556:Prep UTSW 10 45158314 frame shift probably null
R6696:Prep UTSW 10 45153078 missense probably damaging 1.00
R6737:Prep UTSW 10 45097495 missense possibly damaging 0.62
R6762:Prep UTSW 10 45148123 critical splice donor site probably null
R6830:Prep UTSW 10 45097501 missense probably benign 0.01
R7105:Prep UTSW 10 45126063 missense probably benign
R7193:Prep UTSW 10 45092699 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TGTAGGAAGCTGAGGGATTTCC -3'
(R):5'- TGTGCGCATCTGTTCTACAATATG -3'

Sequencing Primer
(F):5'- GAAGCTGAGGGATTTCCACTCTC -3'
(R):5'- ACACTGCTTGGGATCTCAAG -3'
Posted On2014-10-01