Incidental Mutation 'R2166:Nalcn'
ID235508
Institutional Source Beutler Lab
Gene Symbol Nalcn
Ensembl Gene ENSMUSG00000000197
Gene Namesodium leak channel, non-selective
SynonymsA530023G15Rik, Vgcnl1
MMRRC Submission 040169-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R2166 (G1)
Quality Score225
Status Validated
Chromosome14
Chromosomal Location123276634-123627144 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 123369951 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Phenylalanine at position 702 (Y702F)
Ref Sequence ENSEMBL: ENSMUSP00000000201 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000000201]
Predicted Effect probably benign
Transcript: ENSMUST00000000201
AA Change: Y702F

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000000201
Gene: ENSMUSG00000000197
AA Change: Y702F

DomainStartEndE-ValueType
Pfam:Ion_trans 35 333 2.8e-37 PFAM
low complexity region 338 348 N/A INTRINSIC
Pfam:Ion_trans 383 609 5.7e-34 PFAM
coiled coil region 796 830 N/A INTRINSIC
Pfam:Ion_trans 885 1166 2.4e-42 PFAM
Pfam:Ion_trans 1209 1458 6.9e-30 PFAM
low complexity region 1548 1560 N/A INTRINSIC
low complexity region 1634 1649 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000227541
Predicted Effect noncoding transcript
Transcript: ENSMUST00000227818
Predicted Effect noncoding transcript
Transcript: ENSMUST00000228860
Meta Mutation Damage Score 0.09 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.5%
  • 20x: 95.7%
Validation Efficiency 100% (42/42)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] NALCN forms a voltage-independent, nonselective, noninactivating cation channel permeable to Na+, K+, and Ca(2+). It is responsible for the neuronal background sodium leak conductance (Lu et al., 2007 [PubMed 17448995]).[supplied by OMIM, Mar 2008]
PHENOTYPE: Mice homozygous for a null allele exhibit abnormal breathing at birth and die within 24 hours. Mice homozygous for a gain of function ENU mutation exhibit reduced the total amount and episode duration of REMS. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrv1 A T 13: 81,568,643 F779I probably damaging Het
Arsi G A 18: 60,916,651 G202E probably benign Het
Birc6 A T 17: 74,635,795 T2761S probably benign Het
Cav1 A T 6: 17,339,431 I141F possibly damaging Het
Gm973 A G 1: 59,526,739 D39G possibly damaging Het
Gpr1 A G 1: 63,183,948 F43L probably benign Het
Gucy1a2 T A 9: 3,579,513 probably null Het
Il1b A T 2: 129,365,048 M264K probably damaging Het
Itpr1 A G 6: 108,388,225 Y38C probably damaging Het
Kcnb2 A C 1: 15,711,316 D804A possibly damaging Het
Kcnt1 T A 2: 25,891,183 probably benign Het
Krt6b T C 15: 101,678,615 probably null Het
Mef2a A G 7: 67,266,122 V144A probably damaging Het
Mroh3 A G 1: 136,186,053 M666T probably benign Het
Mslnl G A 17: 25,742,934 V128M probably damaging Het
Napepld T A 5: 21,683,232 K73I possibly damaging Het
Olfr191 T A 16: 59,085,586 K299I probably benign Het
Olfr935 G A 9: 38,995,217 Q73* probably null Het
Pappa A C 4: 65,156,445 D412A probably damaging Het
Plbd1 A G 6: 136,613,790 probably null Het
Ppp1r10 G T 17: 35,930,589 R752L unknown Het
Prep T C 10: 45,092,655 probably benign Het
Ptch1 T G 13: 63,524,959 E944A probably benign Het
Ptprz1 A G 6: 23,045,633 N2134S possibly damaging Het
Rhbdl3 A G 11: 80,319,697 Y92C probably damaging Het
Rtkn2 T C 10: 68,041,696 S532P possibly damaging Het
Rtl1 T A 12: 109,590,554 H1617L probably damaging Het
Skint6 T A 4: 112,854,452 N956I probably benign Het
Slc13a2 A G 11: 78,403,075 V287A probably benign Het
Slc9a2 A G 1: 40,742,768 K386E probably damaging Het
Spata20 G A 11: 94,479,104 H789Y probably benign Het
Stk19 A G 17: 34,832,510 I23T possibly damaging Het
Tonsl A G 15: 76,637,313 I293T probably benign Het
Topbp1 A G 9: 103,312,929 probably null Het
Trappc2l T A 8: 122,613,162 S44T probably benign Het
Tsr1 A G 11: 74,907,454 probably null Het
Ugdh A G 5: 65,417,014 probably benign Het
Unc119 A G 11: 78,347,335 probably null Het
Zkscan14 G A 5: 145,196,134 P196S probably benign Het
Zmat4 T C 8: 23,902,136 L36P probably damaging Het
Other mutations in Nalcn
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00952:Nalcn APN 14 123348789 missense probably benign 0.00
IGL00964:Nalcn APN 14 123295384 splice site probably benign
IGL01310:Nalcn APN 14 123317249 missense probably benign 0.00
IGL01578:Nalcn APN 14 123572091 missense probably benign 0.00
IGL01925:Nalcn APN 14 123291848 missense possibly damaging 0.88
IGL02072:Nalcn APN 14 123323358 missense probably benign 0.05
IGL02096:Nalcn APN 14 123594503 missense probably benign 0.11
IGL02212:Nalcn APN 14 123515330 missense probably damaging 0.99
IGL02306:Nalcn APN 14 123323338 missense probably benign 0.07
IGL02471:Nalcn APN 14 123323314 missense probably benign 0.02
IGL02478:Nalcn APN 14 123321305 missense probably benign 0.26
IGL02551:Nalcn APN 14 123323338 missense probably benign 0.07
IGL02630:Nalcn APN 14 123317879 missense probably benign 0.16
IGL02632:Nalcn APN 14 123317853 missense probably benign 0.11
IGL02661:Nalcn APN 14 123592909 splice site probably benign
IGL02830:Nalcn APN 14 123293469 missense probably damaging 0.98
IGL02939:Nalcn APN 14 123298872 missense probably null 1.00
IGL03035:Nalcn APN 14 123278218 nonsense probably null
IGL03226:Nalcn APN 14 123281115 missense probably benign 0.00
IGL03242:Nalcn APN 14 123321487 missense possibly damaging 0.91
Narnia UTSW 14 123291047 missense probably benign 0.11
R0019:Nalcn UTSW 14 123507489 missense probably benign 0.18
R0144:Nalcn UTSW 14 123371536 missense probably damaging 0.96
R0144:Nalcn UTSW 14 123409839 splice site probably benign
R0359:Nalcn UTSW 14 123299168 missense probably damaging 1.00
R0383:Nalcn UTSW 14 123507559 missense probably benign 0.01
R0400:Nalcn UTSW 14 123290960 splice site probably benign
R0467:Nalcn UTSW 14 123291047 missense probably benign 0.11
R0506:Nalcn UTSW 14 123596614 missense possibly damaging 0.82
R0583:Nalcn UTSW 14 123294343 missense possibly damaging 0.46
R0620:Nalcn UTSW 14 123299141 splice site probably benign
R0624:Nalcn UTSW 14 123370032 missense probably benign
R0883:Nalcn UTSW 14 123464740 missense probably damaging 1.00
R1381:Nalcn UTSW 14 123314105 missense probably damaging 1.00
R1467:Nalcn UTSW 14 123464656 splice site probably benign
R1689:Nalcn UTSW 14 123285254 missense probably damaging 1.00
R1726:Nalcn UTSW 14 123308404 missense probably damaging 1.00
R1774:Nalcn UTSW 14 123278266 missense probably benign
R1854:Nalcn UTSW 14 123460412 missense probably damaging 1.00
R1869:Nalcn UTSW 14 123594553 missense possibly damaging 0.96
R1871:Nalcn UTSW 14 123594553 missense possibly damaging 0.96
R1873:Nalcn UTSW 14 123283601 missense probably benign 0.00
R1899:Nalcn UTSW 14 123316126 missense possibly damaging 0.50
R1915:Nalcn UTSW 14 123302769 missense probably benign 0.08
R2016:Nalcn UTSW 14 123594581 splice site probably null
R2034:Nalcn UTSW 14 123283603 missense probably benign 0.01
R2087:Nalcn UTSW 14 123281145 missense probably benign
R2149:Nalcn UTSW 14 123370017 missense probably benign 0.01
R2157:Nalcn UTSW 14 123409752 missense probably benign 0.32
R2932:Nalcn UTSW 14 123593018 missense probably benign 0.06
R3408:Nalcn UTSW 14 123596617 missense probably null 0.98
R3778:Nalcn UTSW 14 123464716 missense probably damaging 1.00
R3807:Nalcn UTSW 14 123278187 missense probably damaging 1.00
R3835:Nalcn UTSW 14 123293422 splice site probably benign
R3937:Nalcn UTSW 14 123369945 missense probably benign 0.00
R4001:Nalcn UTSW 14 123596594 missense probably damaging 1.00
R4015:Nalcn UTSW 14 123486387 missense probably damaging 1.00
R4033:Nalcn UTSW 14 123599989 splice site probably benign
R4231:Nalcn UTSW 14 123599913 missense probably benign 0.01
R4464:Nalcn UTSW 14 123323350 missense probably benign
R4512:Nalcn UTSW 14 123295448 missense probably damaging 1.00
R4542:Nalcn UTSW 14 123321477 synonymous silent
R4557:Nalcn UTSW 14 123321235 intron probably benign
R4869:Nalcn UTSW 14 123599884 missense probably benign 0.44
R5083:Nalcn UTSW 14 123323294 splice site probably null
R5109:Nalcn UTSW 14 123278238 missense possibly damaging 0.86
R5131:Nalcn UTSW 14 123515770 missense probably damaging 0.98
R5158:Nalcn UTSW 14 123515737 missense probably damaging 1.00
R5259:Nalcn UTSW 14 123515651 missense possibly damaging 0.94
R5422:Nalcn UTSW 14 123515365 missense probably damaging 1.00
R5514:Nalcn UTSW 14 123283711 missense probably benign 0.14
R5523:Nalcn UTSW 14 123409743 missense probably damaging 1.00
R5551:Nalcn UTSW 14 123278286 missense possibly damaging 0.57
R5667:Nalcn UTSW 14 123295406 missense probably damaging 1.00
R5671:Nalcn UTSW 14 123295406 missense probably damaging 1.00
R5750:Nalcn UTSW 14 123572038 missense probably benign
R5765:Nalcn UTSW 14 123464726 missense possibly damaging 0.46
R6324:Nalcn UTSW 14 123409749 missense possibly damaging 0.83
R6523:Nalcn UTSW 14 123317843 missense probably benign 0.00
R6558:Nalcn UTSW 14 123486507 missense probably benign
R6631:Nalcn UTSW 14 123460251 missense probably benign 0.17
R6667:Nalcn UTSW 14 123321323 missense probably damaging 1.00
R6670:Nalcn UTSW 14 123464672 missense possibly damaging 0.96
R6724:Nalcn UTSW 14 123298067 missense probably damaging 0.99
R6731:Nalcn UTSW 14 123599934 missense probably benign 0.22
R6957:Nalcn UTSW 14 123507554 missense probably damaging 0.96
R6970:Nalcn UTSW 14 123314094 missense possibly damaging 0.46
R7010:Nalcn UTSW 14 123293465 missense probably damaging 1.00
R7018:Nalcn UTSW 14 123409821 missense probably damaging 1.00
R7040:Nalcn UTSW 14 123287855 missense probably benign
R7089:Nalcn UTSW 14 123278349 missense probably benign 0.01
R7128:Nalcn UTSW 14 123594502 missense probably damaging 0.99
R7149:Nalcn UTSW 14 123599865 missense probably benign 0.02
X0060:Nalcn UTSW 14 123285241 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CAGGAGCAAGTTGGCATTCG -3'
(R):5'- TGAAATGCCACCTCCCATTC -3'

Sequencing Primer
(F):5'- GCAAGTTGGCATTCGAGTTTTTAAC -3'
(R):5'- CTACTTCCTGAGTAACCCTGATCTG -3'
Posted On2014-10-01