Incidental Mutation 'R0200:Pdgfra'
ID23552
Institutional Source Beutler Lab
Gene Symbol Pdgfra
Ensembl Gene ENSMUSG00000029231
Gene Nameplatelet derived growth factor receptor, alpha polypeptide
SynonymsPdgfr-2, CD140a
MMRRC Submission 038457-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0200 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location75152292-75198215 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 75163777 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 98 (Y98H)
Ref Sequence ENSEMBL: ENSMUSP00000144132 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000000476] [ENSMUST00000168162] [ENSMUST00000200822] [ENSMUST00000201711] [ENSMUST00000202161] [ENSMUST00000202186] [ENSMUST00000202681] [ENSMUST00000202992]
Predicted Effect probably damaging
Transcript: ENSMUST00000000476
AA Change: Y98H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000000476
Gene: ENSMUSG00000029231
AA Change: Y98H

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
IG 34 122 6.07e-3 SMART
IG_like 135 206 1.7e1 SMART
IGc2 226 297 8.72e-4 SMART
IG 322 414 2.86e0 SMART
transmembrane domain 527 549 N/A INTRINSIC
TyrKc 593 950 8.51e-141 SMART
Blast:TyrKc 960 991 3e-8 BLAST
low complexity region 1063 1082 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000168162
AA Change: Y98H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000127173
Gene: ENSMUSG00000029231
AA Change: Y98H

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
IG 34 122 6.07e-3 SMART
IG_like 135 206 1.7e1 SMART
IGc2 226 297 8.72e-4 SMART
IG 322 414 2.86e0 SMART
transmembrane domain 527 549 N/A INTRINSIC
TyrKc 593 950 8.51e-141 SMART
Blast:TyrKc 960 991 3e-8 BLAST
low complexity region 1063 1082 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000200822
AA Change: Y98H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000144634
Gene: ENSMUSG00000029231
AA Change: Y98H

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
IG 34 122 2.6e-5 SMART
IG_like 135 206 7e-2 SMART
Blast:IG 220 243 3e-6 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000201241
Predicted Effect probably damaging
Transcript: ENSMUST00000201711
AA Change: Y98H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000143891
Gene: ENSMUSG00000029231
AA Change: Y98H

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
IG 34 122 6.07e-3 SMART
IG_like 135 206 1.7e1 SMART
IGc2 226 297 8.72e-4 SMART
IG 322 414 2.86e0 SMART
transmembrane domain 527 549 N/A INTRINSIC
Pfam:Pkinase 593 701 9.9e-14 PFAM
Pfam:Pkinase_Tyr 593 750 5.2e-32 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000202161
SMART Domains Protein: ENSMUSP00000144485
Gene: ENSMUSG00000029231

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
Blast:IG 34 88 5e-32 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000202186
AA Change: Y98H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000144543
Gene: ENSMUSG00000029231
AA Change: Y98H

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
IG 34 122 2.6e-5 SMART
IG_like 135 206 7e-2 SMART
IGc2 226 297 3.6e-6 SMART
IG 322 414 1.2e-2 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000202681
AA Change: Y98H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000143906
Gene: ENSMUSG00000029231
AA Change: Y98H

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
IG 34 122 6.07e-3 SMART
IG_like 135 206 1.7e1 SMART
IGc2 226 297 8.72e-4 SMART
IG 322 414 2.86e0 SMART
transmembrane domain 527 549 N/A INTRINSIC
Pfam:Pkinase 593 701 9.9e-14 PFAM
Pfam:Pkinase_Tyr 593 750 5.2e-32 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000202992
AA Change: Y98H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000144132
Gene: ENSMUSG00000029231
AA Change: Y98H

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
IG 34 122 2.6e-5 SMART
Coding Region Coverage
  • 1x: 98.8%
  • 3x: 97.8%
  • 10x: 94.7%
  • 20x: 86.2%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a member of the receptor tyrosine kinase family of proteins. Binding of platelet-derived growth factor protein ligands to this receptor triggers receptor dimerization and autophosphorylation, resulting in the activation of several downstream signaling pathways. Signaling through the encoded receptor plays a role in gastrulation and the development of nearly all organ systems. Mice lacking a functional copy of this gene reportedly exhibit defects in lung, skeleton, testis and the central nervous system, and die soon after birth. Alternative splicing and intronic polyadenylation of gene transcripts have been implicated in muscle regeneration and fibrosis in adult mice. [provided by RefSeq, Jan 2017]
PHENOTYPE: Homozygotes for targeted null mutations exhibit incomplete cephalic closure, increased apoptosis of neural crest cells, impaired myotome and testis formation, abnormal mucosal linings, thoracic skeletal defects, and midgestational lethality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 86 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A730017C20Rik A G 18: 59,062,459 probably null Het
Aatf T C 11: 84,445,676 K466E probably damaging Het
Abcc3 T C 11: 94,355,074 D1245G probably damaging Het
Adam12 T C 7: 133,974,416 probably null Het
Akap11 A G 14: 78,510,753 V1398A probably benign Het
Ank1 T G 8: 23,096,812 L461R probably damaging Het
Ankfn1 T C 11: 89,441,966 S402G possibly damaging Het
Arhgef40 A C 14: 51,996,974 E911D probably damaging Het
Atp2b1 C T 10: 98,979,814 Q107* probably null Het
BC117090 T C 16: 36,323,024 probably null Het
Cacng3 T A 7: 122,671,785 C4* probably null Het
Ccdc129 T C 6: 55,897,956 L297P probably benign Het
Cds1 G A 5: 101,814,433 V305M probably damaging Het
Cecr2 T G 6: 120,761,797 F1162V probably damaging Het
Cfap70 A T 14: 20,448,563 Y19N probably damaging Het
Chrm5 A G 2: 112,480,720 V17A probably benign Het
Col20a1 T C 2: 181,000,438 I714T probably damaging Het
Cpeb2 T A 5: 43,261,776 M156K possibly damaging Het
Defb25 C A 2: 152,622,412 V71L probably benign Het
Dhx35 A T 2: 158,829,623 M325L probably benign Het
Dhx57 A T 17: 80,251,473 L1019H probably damaging Het
Dnah6 T A 6: 73,069,420 D3195V probably damaging Het
Dph5 A G 3: 115,928,703 S277G probably benign Het
Dpm1 C A 2: 168,223,155 probably null Het
Dsg1a A T 18: 20,340,938 M1023L probably benign Het
Egf A G 3: 129,706,233 Y252H probably benign Het
Egf A G 3: 129,737,549 S126P probably damaging Het
Enam T C 5: 88,493,027 W183R possibly damaging Het
Foxn1 T C 11: 78,361,040 Y455C probably damaging Het
Gm14085 T A 2: 122,527,447 *661R probably null Het
Iars A T 13: 49,726,202 D983V possibly damaging Het
Ikzf4 C A 10: 128,634,676 G325V probably damaging Het
Il1rl1 T A 1: 40,441,303 W31R possibly damaging Het
Ip6k3 C T 17: 27,145,025 D350N probably damaging Het
Irgc1 T C 7: 24,432,006 D462G probably benign Het
Jph3 A G 8: 121,784,833 E520G probably benign Het
Kcna2 T A 3: 107,105,160 D352E probably benign Het
Klk4 T A 7: 43,885,361 I248N probably damaging Het
Krtap16-1 T C 11: 99,985,297 Y427C probably damaging Het
Lgr4 A G 2: 109,970,690 probably null Het
Lhpp C T 7: 132,610,677 probably benign Het
Lypd3 T A 7: 24,640,231 V241D probably damaging Het
Lyz2 T A 10: 117,280,773 N57Y possibly damaging Het
Man1a A G 10: 54,074,498 V176A probably damaging Het
Mcm4 G A 16: 15,629,639 T487I probably benign Het
Mettl21c T A 1: 44,013,654 I68F probably damaging Het
Miip T A 4: 147,862,263 T313S probably damaging Het
Mog A T 17: 37,012,419 I209K probably damaging Het
Myo1c C A 11: 75,672,182 D997E probably benign Het
Npc1 T C 18: 12,219,204 Y146C probably damaging Het
Nploc4 A G 11: 120,413,681 L238P probably damaging Het
Olfr231 T C 1: 174,117,512 H168R probably benign Het
Olfr531 T C 7: 140,400,875 Y57C probably damaging Het
Olfr56 T A 11: 49,135,047 M285K probably damaging Het
Opa1 A G 16: 29,614,129 N544S probably benign Het
Pam C T 1: 97,894,401 probably null Het
Plcz1 C T 6: 139,990,733 R590H probably damaging Het
Plxdc1 T C 11: 97,934,012 Y339C probably damaging Het
Plxna1 T C 6: 89,323,593 N1583S probably damaging Het
Plxna4 C T 6: 32,197,088 V1191M probably damaging Het
Polk T A 13: 96,496,822 N238Y probably benign Het
Ptprq T C 10: 107,685,157 N718S probably benign Het
Rsrc1 A T 3: 67,180,861 H176L probably damaging Het
Sbno1 T C 5: 124,384,541 D1072G probably damaging Het
Scmh1 A G 4: 120,483,831 K238R probably damaging Het
Senp7 A G 16: 56,123,873 T187A possibly damaging Het
Slc12a4 T C 8: 105,951,617 R315G probably benign Het
Slc16a10 A G 10: 40,040,616 V430A probably benign Het
Slc26a7 T C 4: 14,621,317 D23G probably benign Het
Slc7a7 A G 14: 54,377,802 L246P probably damaging Het
Spata7 T A 12: 98,663,169 S332T probably benign Het
Spsb1 A G 4: 149,898,216 *274R probably null Het
Sspo T G 6: 48,486,415 V3767G probably null Het
Syt10 C A 15: 89,826,941 A130S probably benign Het
Tgm6 T A 2: 130,152,945 probably null Het
Them7 A C 2: 105,297,917 N81T probably damaging Het
Tinag C A 9: 76,951,935 A464S probably damaging Het
Tmem217 T G 17: 29,526,310 I149L probably benign Het
Trp53rkb T G 2: 166,795,683 D186E probably damaging Het
Vmn1r20 T C 6: 57,432,099 Y137H probably damaging Het
Vmn1r60 T A 7: 5,544,380 L240F probably benign Het
Vmn1r64 A G 7: 5,883,818 M242T probably benign Het
Xkr4 T C 1: 3,670,663 N229S probably benign Het
Zcchc2 T A 1: 106,004,123 L352M probably damaging Het
Zfp217 C T 2: 170,115,462 A539T probably benign Het
Zfp638 T C 6: 83,967,354 L1018P probably damaging Het
Other mutations in Pdgfra
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00489:Pdgfra APN 5 75163679 missense probably benign 0.40
IGL00574:Pdgfra APN 5 75181047 missense probably damaging 1.00
IGL00906:Pdgfra APN 5 75180173 missense probably benign 0.00
IGL00964:Pdgfra APN 5 75175065 missense probably damaging 1.00
IGL01467:Pdgfra APN 5 75185631 critical splice donor site probably null
IGL01485:Pdgfra APN 5 75163652 missense probably benign 0.02
IGL01556:Pdgfra APN 5 75177691 missense probably damaging 1.00
IGL01949:Pdgfra APN 5 75170665 missense probably damaging 0.98
IGL02066:Pdgfra APN 5 75170580 missense possibly damaging 0.55
IGL02271:Pdgfra APN 5 75187906 missense probably damaging 1.00
IGL02726:Pdgfra APN 5 75194957 nonsense probably null
IGL02858:Pdgfra APN 5 75194974 missense probably damaging 1.00
IGL03306:Pdgfra APN 5 75192533 missense possibly damaging 0.49
Pony_express UTSW 5 75189234 nonsense probably null
P0033:Pdgfra UTSW 5 75192561 missense probably damaging 1.00
PIT4472001:Pdgfra UTSW 5 75180246 missense probably damaging 1.00
R0134:Pdgfra UTSW 5 75166511 missense probably damaging 1.00
R0254:Pdgfra UTSW 5 75167935 missense probably damaging 1.00
R0331:Pdgfra UTSW 5 75195052 missense probably damaging 1.00
R0467:Pdgfra UTSW 5 75195036 missense probably damaging 1.00
R0532:Pdgfra UTSW 5 75170773 missense probably benign 0.00
R0608:Pdgfra UTSW 5 75163777 missense probably damaging 1.00
R0765:Pdgfra UTSW 5 75187987 unclassified probably benign
R1171:Pdgfra UTSW 5 75173447 missense probably damaging 0.98
R1372:Pdgfra UTSW 5 75189263 missense probably damaging 0.96
R1530:Pdgfra UTSW 5 75189010 splice site probably null
R1585:Pdgfra UTSW 5 75192603 missense probably damaging 1.00
R1666:Pdgfra UTSW 5 75189020 missense possibly damaging 0.94
R1836:Pdgfra UTSW 5 75183014 missense possibly damaging 0.95
R1868:Pdgfra UTSW 5 75170873 missense probably benign 0.43
R1923:Pdgfra UTSW 5 75163733 missense probably benign 0.03
R2075:Pdgfra UTSW 5 75187948 missense probably damaging 1.00
R2261:Pdgfra UTSW 5 75185523 missense probably benign 0.03
R2262:Pdgfra UTSW 5 75185523 missense probably benign 0.03
R3028:Pdgfra UTSW 5 75174981 missense probably damaging 1.00
R3236:Pdgfra UTSW 5 75167936 missense probably damaging 1.00
R3692:Pdgfra UTSW 5 75189287 missense possibly damaging 0.54
R3701:Pdgfra UTSW 5 75180220 nonsense probably null
R3890:Pdgfra UTSW 5 75167927 missense probably null 0.57
R3901:Pdgfra UTSW 5 75192508 missense probably benign 0.10
R3902:Pdgfra UTSW 5 75192508 missense probably benign 0.10
R4272:Pdgfra UTSW 5 75183070 missense probably benign 0.05
R4532:Pdgfra UTSW 5 75181083 missense probably damaging 1.00
R4660:Pdgfra UTSW 5 75162271 missense possibly damaging 0.82
R4753:Pdgfra UTSW 5 75181524 missense probably damaging 1.00
R4795:Pdgfra UTSW 5 75189311 missense probably benign
R4796:Pdgfra UTSW 5 75189311 missense probably benign
R4884:Pdgfra UTSW 5 75189312 missense probably benign 0.07
R4936:Pdgfra UTSW 5 75195026 missense probably damaging 1.00
R5625:Pdgfra UTSW 5 75189337 critical splice donor site probably null
R5666:Pdgfra UTSW 5 75173495 missense probably benign 0.00
R5670:Pdgfra UTSW 5 75173495 missense probably benign 0.00
R5714:Pdgfra UTSW 5 75186012 missense probably damaging 1.00
R5836:Pdgfra UTSW 5 75163774 missense possibly damaging 0.52
R6126:Pdgfra UTSW 5 75170529 missense probably benign 0.09
R6141:Pdgfra UTSW 5 75173396 missense probably damaging 0.98
R6297:Pdgfra UTSW 5 75173474 missense possibly damaging 0.88
R6363:Pdgfra UTSW 5 75170836 missense possibly damaging 0.91
R6376:Pdgfra UTSW 5 75166519 missense probably benign 0.02
R6485:Pdgfra UTSW 5 75175074 splice site probably null
R6612:Pdgfra UTSW 5 75167842 missense probably benign 0.01
R6641:Pdgfra UTSW 5 75162101 intron probably benign
R6954:Pdgfra UTSW 5 75173394 missense possibly damaging 0.82
R7110:Pdgfra UTSW 5 75189234 nonsense probably null
R7192:Pdgfra UTSW 5 75183106 missense probably damaging 1.00
R7294:Pdgfra UTSW 5 75181651 missense probably benign 0.05
R7347:Pdgfra UTSW 5 75183098 missense possibly damaging 0.91
R7476:Pdgfra UTSW 5 75170603 missense probably damaging 1.00
Z1088:Pdgfra UTSW 5 75166577 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- GCCGTTGTTCATATAAGCCGCCAC -3'
(R):5'- ATGCCCCTTAACTCGGTGACTCAG -3'

Sequencing Primer
(F):5'- AGAAGCTGTCCTTTCTGGC -3'
(R):5'- TCGGTGACTCAGAGGCAG -3'
Posted On2013-04-16