Incidental Mutation 'R2167:Sec31b'
ID235583
Institutional Source Beutler Lab
Gene Symbol Sec31b
Ensembl Gene ENSMUSG00000051984
Gene NameSec31 homolog B (S. cerevisiae)
SynonymsLOC240667, Sec31l2
MMRRC Submission 040170-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.207) question?
Stock #R2167 (G1)
Quality Score225
Status Validated
Chromosome19
Chromosomal Location44516957-44545864 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 44543353 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Isoleucine at position 39 (T39I)
Ref Sequence ENSEMBL: ENSMUSP00000064900 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000063632] [ENSMUST00000111985]
Predicted Effect possibly damaging
Transcript: ENSMUST00000063632
AA Change: T39I

PolyPhen 2 Score 0.888 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000064900
Gene: ENSMUSG00000051984
AA Change: T39I

DomainStartEndE-ValueType
Blast:WD40 56 101 5e-18 BLAST
WD40 110 150 4.76e-6 SMART
WD40 159 197 1.53e1 SMART
WD40 200 245 1.85e0 SMART
WD40 249 289 2.15e-4 SMART
WD40 292 332 6.19e-1 SMART
low complexity region 551 561 N/A INTRINSIC
low complexity region 822 841 N/A INTRINSIC
low complexity region 909 929 N/A INTRINSIC
low complexity region 1009 1018 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000111985
SMART Domains Protein: ENSMUSP00000107616
Gene: ENSMUSG00000051984

DomainStartEndE-ValueType
WD40 2 40 1.53e1 SMART
WD40 43 88 1.85e0 SMART
WD40 92 132 2.15e-4 SMART
WD40 135 175 6.19e-1 SMART
Pfam:Sec16_C 394 612 1.3e-7 PFAM
low complexity region 665 684 N/A INTRINSIC
low complexity region 752 772 N/A INTRINSIC
low complexity region 852 861 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000166808
SMART Domains Protein: ENSMUSP00000126763
Gene: ENSMUSG00000091471

DomainStartEndE-ValueType
Pfam:NDUF_B8 1 71 1.5e-14 PFAM
Meta Mutation Damage Score 0.284 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency 98% (57/58)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein of unknown function. The protein has moderate similarity to rat VAP1 protein which is an endosomal membrane-associated protein, containing a putative Ca2+/calmodulin-dependent kinase II phosphorylation site. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 C T 11: 9,288,532 T710M probably benign Het
Acan A G 7: 79,099,957 E1492G probably benign Het
Acsl1 A G 8: 46,533,590 D638G possibly damaging Het
Acsl6 C A 11: 54,327,157 T207K probably benign Het
Ahnak A T 19: 9,011,494 K3381* probably null Het
Art1 T C 7: 102,106,824 V74A probably damaging Het
Bhmt2 A T 13: 93,662,504 W270R probably benign Het
Calm2 T C 17: 87,435,145 T118A probably benign Het
Ccdc88b G T 19: 6,854,084 Q497K possibly damaging Het
Ccne2 A T 4: 11,197,249 M183L probably benign Het
Cdc42bpg A G 19: 6,317,677 I1026V probably damaging Het
Celsr2 T C 3: 108,413,193 T768A probably damaging Het
Cog5 T C 12: 31,837,289 F470L probably damaging Het
Cpne5 T C 17: 29,162,332 D374G probably damaging Het
Disp2 A C 2: 118,791,685 E966A probably damaging Het
Dmrtc2 C T 7: 24,873,919 probably benign Het
Eif2b3 T A 4: 117,028,540 I93N probably damaging Het
Elfn2 C A 15: 78,672,446 V634L probably benign Het
Fasl T G 1: 161,787,138 S119R probably benign Het
Foxp2 C G 6: 15,437,902 P701A probably damaging Het
Helz T A 11: 107,672,964 probably benign Het
Kctd6 T C 14: 8,222,683 V175A probably benign Het
Leo1 A G 9: 75,445,709 N178S probably benign Het
Lhx6 C A 2: 36,103,359 R80L probably damaging Het
Man1a2 A G 3: 100,591,900 L406P probably damaging Het
Mapkap1 T C 2: 34,597,482 F231L probably damaging Het
Mknk2 A G 10: 80,668,701 Y256H probably damaging Het
Msh6 A G 17: 87,989,483 T1203A probably damaging Het
Nbeal2 T C 9: 110,638,308 Y604C probably damaging Het
Ncam1 G T 9: 49,568,481 Q66K probably benign Het
Nsd2 T A 5: 33,882,919 H933Q probably damaging Het
Olfr1341 T C 4: 118,710,055 V216A probably benign Het
Olfr1564 T A 17: 33,215,568 I262F probably damaging Het
Olfr191 T A 16: 59,085,586 K299I probably benign Het
Olfr709-ps1 A G 7: 106,926,590 Y290H probably damaging Het
Pappa A C 4: 65,156,445 D412A probably damaging Het
Ptch1 T G 13: 63,524,959 E944A probably benign Het
Rassf6 C T 5: 90,603,938 E308K probably damaging Het
Rb1 T C 14: 73,211,651 T680A probably damaging Het
Rfpl4 T A 7: 5,110,853 I104F probably damaging Het
Rin2 C T 2: 145,860,446 T354I probably benign Het
Rnase6 A C 14: 51,130,517 D122A probably benign Het
Rsf1 GGCG GGCGACGGCAGCG 7: 97,579,906 probably benign Het
Slc12a1 A G 2: 125,173,681 I385V probably damaging Het
Slc6a17 A T 3: 107,491,501 Y261* probably null Het
Supt6 G A 11: 78,208,167 P1626L possibly damaging Het
Tbx15 A G 3: 99,326,455 probably benign Het
Telo2 A G 17: 25,110,818 V240A probably benign Het
Trhr C T 15: 44,229,242 L292F probably damaging Het
Trps1 G A 15: 50,831,730 L340F possibly damaging Het
Ube2e1 T C 14: 18,284,429 probably benign Het
Yeats2 T C 16: 20,213,401 probably benign Het
Zbtb39 G A 10: 127,742,975 E473K probably benign Het
Zfp235 T A 7: 24,140,962 S269T possibly damaging Het
Zfp580 C A 7: 5,053,064 P141Q possibly damaging Het
Other mutations in Sec31b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01133:Sec31b APN 19 44527041 missense probably damaging 1.00
IGL01308:Sec31b APN 19 44523683 missense probably benign 0.02
IGL02404:Sec31b APN 19 44534788 missense probably damaging 0.99
IGL02663:Sec31b APN 19 44534278 missense probably damaging 1.00
IGL02728:Sec31b APN 19 44523115 missense probably damaging 0.96
IGL02830:Sec31b APN 19 44531703 missense probably damaging 1.00
IGL03141:Sec31b APN 19 44526320 splice site probably benign
IGL03247:Sec31b APN 19 44518940 missense possibly damaging 0.62
R0049:Sec31b UTSW 19 44520408 splice site probably benign
R0137:Sec31b UTSW 19 44534382 missense probably damaging 1.00
R0238:Sec31b UTSW 19 44525469 unclassified probably benign
R0239:Sec31b UTSW 19 44525469 unclassified probably benign
R0468:Sec31b UTSW 19 44518508 splice site probably benign
R0504:Sec31b UTSW 19 44534786 missense probably damaging 1.00
R0565:Sec31b UTSW 19 44524553 missense probably damaging 1.00
R0627:Sec31b UTSW 19 44525607 missense probably benign
R0749:Sec31b UTSW 19 44524506 missense probably damaging 0.96
R0815:Sec31b UTSW 19 44518173 nonsense probably null
R1162:Sec31b UTSW 19 44517648 nonsense probably null
R1398:Sec31b UTSW 19 44523665 missense probably benign 0.04
R1436:Sec31b UTSW 19 44536195 missense probably damaging 0.99
R1538:Sec31b UTSW 19 44518586 missense probably benign 0.42
R1599:Sec31b UTSW 19 44523153 missense possibly damaging 0.92
R2044:Sec31b UTSW 19 44536156 missense probably benign 0.07
R2135:Sec31b UTSW 19 44534696 missense probably damaging 0.99
R2211:Sec31b UTSW 19 44523150 missense probably damaging 1.00
R2938:Sec31b UTSW 19 44536179 missense probably damaging 0.99
R3113:Sec31b UTSW 19 44518185 nonsense probably null
R4110:Sec31b UTSW 19 44524529 missense possibly damaging 0.62
R4111:Sec31b UTSW 19 44524529 missense possibly damaging 0.62
R4113:Sec31b UTSW 19 44524529 missense possibly damaging 0.62
R4158:Sec31b UTSW 19 44525186 missense probably benign 0.34
R4226:Sec31b UTSW 19 44531710 missense probably benign
R4646:Sec31b UTSW 19 44526621 missense probably benign 0.00
R4732:Sec31b UTSW 19 44532677 missense probably damaging 1.00
R4733:Sec31b UTSW 19 44532677 missense probably damaging 1.00
R4795:Sec31b UTSW 19 44531746 missense probably benign 0.00
R4877:Sec31b UTSW 19 44535733 missense probably damaging 1.00
R5150:Sec31b UTSW 19 44520531 missense probably benign 0.08
R5377:Sec31b UTSW 19 44518637 missense probably damaging 1.00
R5381:Sec31b UTSW 19 44534371 missense probably damaging 1.00
R5708:Sec31b UTSW 19 44523144 missense probably damaging 1.00
R6002:Sec31b UTSW 19 44535764 missense probably benign 0.04
R6185:Sec31b UTSW 19 44543284 missense possibly damaging 0.77
R6675:Sec31b UTSW 19 44523775 missense probably benign
R6946:Sec31b UTSW 19 44534316 missense probably damaging 1.00
R7139:Sec31b UTSW 19 44518936 missense probably benign 0.00
R7237:Sec31b UTSW 19 44517708 missense probably damaging 1.00
R7270:Sec31b UTSW 19 44523043 missense probably benign 0.00
R7340:Sec31b UTSW 19 44528722 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GATCCCTGAATTGCACACAC -3'
(R):5'- GTAACAGCCTTGGACTAGGG -3'

Sequencing Primer
(F):5'- CCACCCCTAGGACCCTCTATCAG -3'
(R):5'- CCTTGCGGTTACCTCTAGAGAAAAG -3'
Posted On2014-10-01