Incidental Mutation 'R2169:Olfr952'
ID235670
Institutional Source Beutler Lab
Gene Symbol Olfr952
Ensembl Gene ENSMUSG00000058856
Gene Nameolfactory receptor 952
SynonymsMOR171-21, GA_x6K02T2PVTD-33124064-33123120
MMRRC Submission 040172-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.053) question?
Stock #R2169 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location39426093-39427148 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 39426358 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 238 (F238L)
Ref Sequence ENSEMBL: ENSMUSP00000073558 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000073895]
Predicted Effect possibly damaging
Transcript: ENSMUST00000073895
AA Change: F238L

PolyPhen 2 Score 0.953 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000073558
Gene: ENSMUSG00000058856
AA Change: F238L

DomainStartEndE-ValueType
Pfam:7tm_4 31 308 8.5e-42 PFAM
Pfam:7tm_1 41 294 3.2e-18 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.5%
  • 20x: 95.6%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4833420G17Rik A G 13: 119,485,813 T606A probably benign Het
Adtrp T A 13: 41,767,429 S221C possibly damaging Het
Ap1g2 T A 14: 55,099,340 probably null Het
Arhgef5 A T 6: 43,274,420 M702L probably benign Het
Axdnd1 A G 1: 156,418,309 V34A probably damaging Het
Ccdc154 T A 17: 25,170,923 V509E probably damaging Het
Cttnbp2 C T 6: 18,426,097 D761N probably benign Het
Ddx18 A T 1: 121,558,409 probably null Het
Fam241b A T 10: 62,109,966 I4N probably damaging Het
Fam69a A T 5: 107,909,459 L411* probably null Het
Gm5800 T C 14: 51,713,678 K155E possibly damaging Het
Hemgn T A 4: 46,396,417 H273L possibly damaging Het
Hsp90aa1 A G 12: 110,692,734 V543A probably damaging Het
Hspa1l A G 17: 34,977,323 K113E probably benign Het
Hspb2 A G 9: 50,751,715 I38T probably damaging Het
Htt A T 5: 34,877,475 E2021D probably benign Het
Lrpprc C T 17: 84,770,077 R394Q probably benign Het
Lrrc8b T C 5: 105,481,887 Y700H probably damaging Het
Mefv A G 16: 3,710,888 V593A probably benign Het
Mrgprh C T 17: 12,876,969 T32M probably benign Het
Mrpl18 A G 17: 12,913,768 probably null Het
Muc1 A G 3: 89,231,596 E504G probably damaging Het
Ndufa13 G A 8: 69,894,519 A77V probably damaging Het
Pgbd5 T A 8: 124,384,624 probably null Het
Pgm5 T A 19: 24,834,815 I118F probably damaging Het
Phyhip T C 14: 70,467,132 F264L possibly damaging Het
Polr3e C T 7: 120,932,137 R176W probably damaging Het
Prkacb C T 3: 146,746,683 probably null Het
Rab19 T G 6: 39,384,041 V41G possibly damaging Het
Rapgef5 A G 12: 117,715,395 Y234C probably benign Het
Slc26a5 T C 5: 21,813,865 T659A probably damaging Het
Slc6a2 G A 8: 92,994,101 V449I probably benign Het
Stab2 A G 10: 86,887,862 S1490P probably damaging Het
Tln1 T C 4: 43,548,005 T713A probably damaging Het
Tmc6 A T 11: 117,769,106 L732Q probably damaging Het
Unc80 C T 1: 66,521,581 H823Y possibly damaging Het
Vmn1r203 A T 13: 22,524,735 K229* probably null Het
Xylt1 G A 7: 117,667,437 G893R probably damaging Het
Ythdf1 A T 2: 180,912,114 S69T probably damaging Het
Zfp114 C T 7: 24,181,084 T285I probably benign Het
Zfp458 T C 13: 67,257,049 E439G probably damaging Het
Zfp65 G A 13: 67,710,380 T55I probably damaging Het
Zmym1 C T 4: 127,054,203 probably null Het
Other mutations in Olfr952
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00976:Olfr952 APN 9 39426657 missense probably benign 0.02
IGL01368:Olfr952 APN 9 39426180 missense probably damaging 1.00
IGL01866:Olfr952 APN 9 39426729 missense probably damaging 0.99
IGL01939:Olfr952 APN 9 39426338 missense probably damaging 1.00
IGL03048:Olfr952 UTSW 9 39426769 missense probably benign 0.00
R0069:Olfr952 UTSW 9 39426892 missense probably damaging 0.98
R1460:Olfr952 UTSW 9 39426207 missense probably benign 0.43
R1478:Olfr952 UTSW 9 39426592 missense possibly damaging 0.91
R1737:Olfr952 UTSW 9 39426958 missense probably damaging 0.99
R2112:Olfr952 UTSW 9 39426670 missense probably benign 0.26
R2225:Olfr952 UTSW 9 39426619 missense probably benign 0.00
R3731:Olfr952 UTSW 9 39427069 start codon destroyed probably benign 0.23
R3777:Olfr952 UTSW 9 39426605 missense possibly damaging 0.75
R3802:Olfr952 UTSW 9 39426286 missense probably damaging 1.00
R4600:Olfr952 UTSW 9 39426435 missense probably benign 0.27
R4887:Olfr952 UTSW 9 39426235 missense possibly damaging 0.80
R5215:Olfr952 UTSW 9 39426623 nonsense probably null
R5813:Olfr952 UTSW 9 39426736 missense probably damaging 1.00
R6140:Olfr952 UTSW 9 39426247 missense possibly damaging 0.91
R6180:Olfr952 UTSW 9 39426712 missense probably damaging 1.00
R6383:Olfr952 UTSW 9 39426234 missense probably damaging 1.00
R6416:Olfr952 UTSW 9 39426891 missense probably damaging 0.98
R6808:Olfr952 UTSW 9 39426540 missense probably damaging 0.99
R7099:Olfr952 UTSW 9 39426303 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- ATTTCTCAGGCTGTAGATCATGAG -3'
(R):5'- CTCACACAGTCTTCCTGCTAAGATTG -3'

Sequencing Primer
(F):5'- GGCTGTAGATCATGAGATTCAACAC -3'
(R):5'- CTGCTAAGATTGTTTTTCTGTAAGGC -3'
Posted On2014-10-01