Incidental Mutation 'R2135:Kcnt2'
ID235699
Institutional Source Beutler Lab
Gene Symbol Kcnt2
Ensembl Gene ENSMUSG00000052726
Gene Namepotassium channel, subfamily T, member 2
SynonymsE330038N15Rik
MMRRC Submission 040138-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.338) question?
Stock #R2135 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location140246158-140612067 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 140428813 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 330 (Y330C)
Ref Sequence ENSEMBL: ENSMUSP00000113333 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000119786] [ENSMUST00000120709] [ENSMUST00000120796]
Predicted Effect probably damaging
Transcript: ENSMUST00000060201
AA Change: Y330C

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000054623
Gene: ENSMUSG00000052726
AA Change: Y330C

DomainStartEndE-ValueType
transmembrane domain 64 83 N/A INTRINSIC
transmembrane domain 103 125 N/A INTRINSIC
transmembrane domain 138 160 N/A INTRINSIC
Pfam:Ion_trans_2 199 282 2.8e-15 PFAM
Pfam:BK_channel_a 424 533 1.3e-31 PFAM
low complexity region 655 670 N/A INTRINSIC
low complexity region 677 689 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000119786
AA Change: Y330C

PolyPhen 2 Score 0.912 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000113535
Gene: ENSMUSG00000052726
AA Change: Y330C

DomainStartEndE-ValueType
transmembrane domain 64 83 N/A INTRINSIC
transmembrane domain 103 125 N/A INTRINSIC
transmembrane domain 138 160 N/A INTRINSIC
Pfam:Ion_trans_2 199 282 2.6e-15 PFAM
Pfam:BK_channel_a 422 476 2.3e-16 PFAM
low complexity region 598 613 N/A INTRINSIC
low complexity region 620 632 N/A INTRINSIC
low complexity region 699 714 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000120709
AA Change: Y330C

PolyPhen 2 Score 0.986 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000112887
Gene: ENSMUSG00000052726
AA Change: Y330C

DomainStartEndE-ValueType
transmembrane domain 64 83 N/A INTRINSIC
transmembrane domain 103 125 N/A INTRINSIC
transmembrane domain 138 160 N/A INTRINSIC
Pfam:Ion_trans_2 199 282 2.7e-15 PFAM
Pfam:BK_channel_a 422 527 1.5e-39 PFAM
low complexity region 648 663 N/A INTRINSIC
low complexity region 670 682 N/A INTRINSIC
low complexity region 749 764 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000120796
AA Change: Y330C

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000113333
Gene: ENSMUSG00000052726
AA Change: Y330C

DomainStartEndE-ValueType
transmembrane domain 64 83 N/A INTRINSIC
transmembrane domain 103 125 N/A INTRINSIC
transmembrane domain 138 160 N/A INTRINSIC
Pfam:Ion_trans_2 199 282 2.8e-15 PFAM
Pfam:BK_channel_a 422 527 1.5e-39 PFAM
low complexity region 648 663 N/A INTRINSIC
low complexity region 670 682 N/A INTRINSIC
Meta Mutation Damage Score 0.17 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.6%
Validation Efficiency 100% (70/70)
MGI Phenotype PHENOTYPE: Mice homozygous for a null allele are viable with normal pain and itch responses. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930522L14Rik A T 5: 109,737,643 H116Q probably benign Het
9230110F15Rik A C 9: 35,839,183 probably null Het
Adamts16 C A 13: 70,801,007 L178F probably damaging Het
Adgrv1 A G 13: 81,524,557 probably null Het
Akap9 A G 5: 4,064,509 T46A probably damaging Het
Ankrd2 T C 19: 42,044,059 L253P probably damaging Het
Arap3 T C 18: 37,974,456 D1336G probably damaging Het
Cacna2d2 C A 9: 107,526,513 L992I possibly damaging Het
Cdhr2 T A 13: 54,720,947 I574N probably damaging Het
Cecr2 C T 6: 120,720,962 T74M probably damaging Het
Ces5a C A 8: 93,499,741 E481D probably benign Het
Cfap74 C G 4: 155,429,940 N544K probably damaging Het
Cfap74 T A 4: 155,429,951 L548Q probably damaging Het
Cfb C T 17: 34,857,278 V1145I possibly damaging Het
CK137956 A G 4: 127,951,640 probably benign Het
Commd10 T A 18: 46,990,537 L153Q possibly damaging Het
Cox6c T C 15: 35,937,283 probably benign Het
Dock4 A G 12: 40,745,668 Y828C probably benign Het
Ermp1 T C 19: 29,646,065 D119G possibly damaging Het
Ext1 G T 15: 53,101,744 Q409K possibly damaging Het
Fat4 A T 3: 38,980,733 I2845F probably damaging Het
Frmd6 A G 12: 70,894,997 N494S probably benign Het
Fscn3 A G 6: 28,431,584 T305A probably benign Het
Gbx1 G T 5: 24,526,222 R199S possibly damaging Het
Gm11437 T C 11: 84,153,812 R192G probably damaging Het
Gucy2c T A 6: 136,723,728 D572V probably damaging Het
Idh1 A C 1: 65,161,919 M291R probably damaging Het
Kdm4a A G 4: 118,142,459 L922P probably damaging Het
L3mbtl2 A G 15: 81,682,014 D346G possibly damaging Het
Lsm14a A G 7: 34,371,184 S96P probably damaging Het
Ltn1 A G 16: 87,382,713 L1520P probably damaging Het
March6 A T 15: 31,509,764 C26* probably null Het
Msra G A 14: 64,123,208 P228L probably damaging Het
Mycbp2 A T 14: 103,145,942 D395E probably benign Het
Mycbp2 T C 14: 103,208,893 Y1800C probably damaging Het
Ncr1 C A 7: 4,340,757 probably benign Het
Nkd1 T C 8: 88,591,650 I201T probably benign Het
Nsrp1 A T 11: 77,055,008 probably benign Het
Olfr330 A C 11: 58,529,785 I67S probably damaging Het
Olfr873 T A 9: 20,300,297 D32E probably benign Het
Pkdrej T C 15: 85,816,506 Y1743C probably damaging Het
Plekha5 T A 6: 140,580,499 H281Q possibly damaging Het
Ppp2r3a A C 9: 101,211,558 M522R probably damaging Het
Prdm12 T C 2: 31,640,313 F72S possibly damaging Het
Prima1 A T 12: 103,202,690 F106L probably damaging Het
Ptchd4 A G 17: 42,317,074 H142R probably benign Het
Rasgrf2 G A 13: 91,972,255 A793V probably benign Het
Rbsn T A 6: 92,189,873 M597L probably benign Het
Ripk4 A T 16: 97,743,733 D571E probably damaging Het
Rp9 T C 9: 22,468,129 K25E possibly damaging Het
Sec31b T C 19: 44,534,696 S211G probably damaging Het
Shank2 C T 7: 144,411,234 P1070S probably damaging Het
Sla A G 15: 66,782,714 V241A probably benign Het
Slc25a40 A G 5: 8,427,489 T25A possibly damaging Het
Slc3a2 A G 19: 8,708,244 S164P probably benign Het
Slc7a5 A T 8: 121,883,705 W457R probably null Het
Slco6c1 A G 1: 97,104,817 M303T probably benign Het
Smim10l1 T C 6: 133,105,526 F12S probably damaging Het
Syne2 A G 12: 75,952,786 I2318V probably damaging Het
Tecta A C 9: 42,340,285 C1781G probably damaging Het
Timmdc1 A T 16: 38,498,951 H280Q probably benign Het
Tktl2 G A 8: 66,512,347 V186M probably damaging Het
Tmem30b A G 12: 73,545,333 L336P probably damaging Het
Tmem94 A G 11: 115,794,749 I943V probably benign Het
Tshb A G 3: 102,778,148 probably null Het
Vcpip1 A G 1: 9,747,810 V116A probably benign Het
Vmn2r76 A G 7: 86,231,011 Y156H probably benign Het
Zcrb1 T C 15: 93,397,186 N23S probably damaging Het
Zfyve26 T C 12: 79,246,052 R2108G possibly damaging Het
Other mutations in Kcnt2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00561:Kcnt2 APN 1 140523098 missense probably damaging 1.00
IGL00673:Kcnt2 APN 1 140596051 missense possibly damaging 0.60
IGL00806:Kcnt2 APN 1 140523211 missense probably damaging 1.00
IGL01135:Kcnt2 APN 1 140354555 critical splice donor site probably null 0.00
IGL01412:Kcnt2 APN 1 140570417 missense probably benign 0.02
IGL01777:Kcnt2 APN 1 140595998 missense probably benign 0.20
IGL01780:Kcnt2 APN 1 140351269 missense probably benign 0.09
IGL02134:Kcnt2 APN 1 140376383 missense probably benign
IGL02350:Kcnt2 APN 1 140351269 missense probably benign 0.09
IGL02357:Kcnt2 APN 1 140351269 missense probably benign 0.09
IGL02481:Kcnt2 APN 1 140354561 splice site probably benign
IGL02483:Kcnt2 APN 1 140354561 splice site probably benign
IGL02866:Kcnt2 APN 1 140425248 missense probably damaging 1.00
IGL02891:Kcnt2 APN 1 140574806 missense probably damaging 1.00
IGL03007:Kcnt2 APN 1 140354507 missense possibly damaging 0.50
IGL03024:Kcnt2 APN 1 140570455 missense probably benign 0.00
IGL03231:Kcnt2 APN 1 140534002 intron probably benign
R0230:Kcnt2 UTSW 1 140246345 missense probably benign 0.00
R0367:Kcnt2 UTSW 1 140351225 missense probably damaging 1.00
R0486:Kcnt2 UTSW 1 140509480 nonsense probably null
R0543:Kcnt2 UTSW 1 140609614 missense probably damaging 1.00
R0849:Kcnt2 UTSW 1 140507762 missense probably damaging 1.00
R1123:Kcnt2 UTSW 1 140573608 missense probably damaging 1.00
R1156:Kcnt2 UTSW 1 140428855 missense probably damaging 1.00
R1425:Kcnt2 UTSW 1 140383028 missense probably damaging 1.00
R1530:Kcnt2 UTSW 1 140484232 nonsense probably null
R1546:Kcnt2 UTSW 1 140431378 missense probably benign 0.01
R1728:Kcnt2 UTSW 1 140354547 missense probably benign 0.00
R1729:Kcnt2 UTSW 1 140354547 missense probably benign 0.00
R1730:Kcnt2 UTSW 1 140354547 missense probably benign 0.00
R1739:Kcnt2 UTSW 1 140354547 missense probably benign 0.00
R1762:Kcnt2 UTSW 1 140354547 missense probably benign 0.00
R1783:Kcnt2 UTSW 1 140354547 missense probably benign 0.00
R1784:Kcnt2 UTSW 1 140354547 missense probably benign 0.00
R1785:Kcnt2 UTSW 1 140354547 missense probably benign 0.00
R1862:Kcnt2 UTSW 1 140425330 missense probably damaging 1.00
R1887:Kcnt2 UTSW 1 140584247 missense probably damaging 0.99
R1889:Kcnt2 UTSW 1 140584293 missense probably damaging 1.00
R1894:Kcnt2 UTSW 1 140425341 missense probably damaging 1.00
R2005:Kcnt2 UTSW 1 140553018 missense probably damaging 0.98
R2044:Kcnt2 UTSW 1 140375154 missense probably benign 0.14
R2115:Kcnt2 UTSW 1 140552963 missense probably damaging 1.00
R2201:Kcnt2 UTSW 1 140509441 missense probably damaging 1.00
R2212:Kcnt2 UTSW 1 140530800 missense probably damaging 1.00
R2267:Kcnt2 UTSW 1 140573683 splice site probably null
R2442:Kcnt2 UTSW 1 140376353 missense possibly damaging 0.59
R3121:Kcnt2 UTSW 1 140428884 missense probably damaging 0.97
R3176:Kcnt2 UTSW 1 140609639 missense probably benign 0.16
R3276:Kcnt2 UTSW 1 140609639 missense probably benign 0.16
R3704:Kcnt2 UTSW 1 140533968 missense probably damaging 1.00
R3944:Kcnt2 UTSW 1 140584287 missense probably damaging 1.00
R4164:Kcnt2 UTSW 1 140609630 missense probably damaging 0.97
R4201:Kcnt2 UTSW 1 140425332 missense probably damaging 0.98
R4501:Kcnt2 UTSW 1 140552980 missense probably damaging 0.99
R4502:Kcnt2 UTSW 1 140507747 missense probably damaging 0.99
R4632:Kcnt2 UTSW 1 140523148 missense possibly damaging 0.90
R4758:Kcnt2 UTSW 1 140518897 missense probably damaging 1.00
R4790:Kcnt2 UTSW 1 140354516 missense probably damaging 0.99
R4892:Kcnt2 UTSW 1 140513025 nonsense probably null
R4973:Kcnt2 UTSW 1 140609650 missense probably damaging 1.00
R5154:Kcnt2 UTSW 1 140351256 missense possibly damaging 0.94
R5296:Kcnt2 UTSW 1 140609615 missense probably damaging 1.00
R5353:Kcnt2 UTSW 1 140426901 missense probably damaging 1.00
R5605:Kcnt2 UTSW 1 140574743 missense possibly damaging 0.59
R5806:Kcnt2 UTSW 1 140509496 missense probably damaging 1.00
R5887:Kcnt2 UTSW 1 140425366 missense probably damaging 1.00
R5917:Kcnt2 UTSW 1 140533928 missense probably damaging 0.99
R5961:Kcnt2 UTSW 1 140507702 missense possibly damaging 0.82
R6123:Kcnt2 UTSW 1 140362980 missense probably damaging 1.00
R6225:Kcnt2 UTSW 1 140426923 nonsense probably null
R6248:Kcnt2 UTSW 1 140509478 missense probably damaging 1.00
R6351:Kcnt2 UTSW 1 140375112 missense probably damaging 1.00
R6380:Kcnt2 UTSW 1 140509584 missense probably damaging 1.00
R6532:Kcnt2 UTSW 1 140584106 missense probably damaging 0.97
R6693:Kcnt2 UTSW 1 140351227 missense probably benign 0.00
R6817:Kcnt2 UTSW 1 140246193 unclassified probably benign
R6856:Kcnt2 UTSW 1 140596004 missense probably damaging 1.00
R6944:Kcnt2 UTSW 1 140584065 missense probably benign 0.00
R6971:Kcnt2 UTSW 1 140512908 missense probably benign 0.01
X0062:Kcnt2 UTSW 1 140512991 missense possibly damaging 0.50
Z1088:Kcnt2 UTSW 1 140573646 missense probably damaging 1.00
Z1088:Kcnt2 UTSW 1 140584158 nonsense probably null
Predicted Primers PCR Primer
(F):5'- GGCTGACTGTTCCGCATTTC -3'
(R):5'- AGCTTGCAAACGTTTGGAGAG -3'

Sequencing Primer
(F):5'- CATTATGTTTATCATGGTGCCATTCG -3'
(R):5'- CAAACGTTTGGAGAGAAAAGTTATC -3'
Posted On2014-10-01