Incidental Mutation 'R2135:Olfr873'
ID235725
Institutional Source Beutler Lab
Gene Symbol Olfr873
Ensembl Gene ENSMUSG00000049028
Gene Nameolfactory receptor 873
SynonymsGA_x6K02T2PVTD-14040245-14041204, MOR145-2
MMRRC Submission 040138-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.094) question?
Stock #R2135 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location20298532-20303599 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 20300297 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 32 (D32E)
Ref Sequence ENSEMBL: ENSMUSP00000153816 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000053919] [ENSMUST00000075717] [ENSMUST00000215540]
Predicted Effect probably benign
Transcript: ENSMUST00000053919
AA Change: D29E

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000054778
Gene: ENSMUSG00000049028
AA Change: D29E

DomainStartEndE-ValueType
Pfam:7tm_4 41 317 1.7e-52 PFAM
Pfam:7TM_GPCR_Srsx 45 315 1.6e-8 PFAM
Pfam:7tm_1 51 300 3e-21 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000075717
AA Change: D33E

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000075135
Gene: ENSMUSG00000049028
AA Change: D33E

DomainStartEndE-ValueType
Pfam:7tm_4 45 321 6.2e-43 PFAM
Pfam:7TM_GPCR_Srsx 49 309 3e-8 PFAM
Pfam:7tm_1 55 304 1.5e-20 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212393
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212793
Predicted Effect noncoding transcript
Transcript: ENSMUST00000213057
Predicted Effect noncoding transcript
Transcript: ENSMUST00000213445
Predicted Effect probably benign
Transcript: ENSMUST00000215540
AA Change: D32E

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000216567
Predicted Effect noncoding transcript
Transcript: ENSMUST00000217193
Meta Mutation Damage Score 0.0456 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.6%
Validation Efficiency 100% (70/70)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930522L14Rik A T 5: 109,737,643 H116Q probably benign Het
9230110F15Rik A C 9: 35,839,183 probably null Het
Adamts16 C A 13: 70,801,007 L178F probably damaging Het
Adgrv1 A G 13: 81,524,557 probably null Het
Akap9 A G 5: 4,064,509 T46A probably damaging Het
Ankrd2 T C 19: 42,044,059 L253P probably damaging Het
Arap3 T C 18: 37,974,456 D1336G probably damaging Het
Cacna2d2 C A 9: 107,526,513 L992I possibly damaging Het
Cdhr2 T A 13: 54,720,947 I574N probably damaging Het
Cecr2 C T 6: 120,720,962 T74M probably damaging Het
Ces5a C A 8: 93,499,741 E481D probably benign Het
Cfap74 C G 4: 155,429,940 N544K probably damaging Het
Cfap74 T A 4: 155,429,951 L548Q probably damaging Het
Cfb C T 17: 34,857,278 V1145I possibly damaging Het
CK137956 A G 4: 127,951,640 probably benign Het
Commd10 T A 18: 46,990,537 L153Q possibly damaging Het
Cox6c T C 15: 35,937,283 probably benign Het
Dock4 A G 12: 40,745,668 Y828C probably benign Het
Ermp1 T C 19: 29,646,065 D119G possibly damaging Het
Ext1 G T 15: 53,101,744 Q409K possibly damaging Het
Fat4 A T 3: 38,980,733 I2845F probably damaging Het
Frmd6 A G 12: 70,894,997 N494S probably benign Het
Fscn3 A G 6: 28,431,584 T305A probably benign Het
Gbx1 G T 5: 24,526,222 R199S possibly damaging Het
Gm11437 T C 11: 84,153,812 R192G probably damaging Het
Gucy2c T A 6: 136,723,728 D572V probably damaging Het
Idh1 A C 1: 65,161,919 M291R probably damaging Het
Kcnt2 A G 1: 140,428,813 Y330C probably damaging Het
Kdm4a A G 4: 118,142,459 L922P probably damaging Het
L3mbtl2 A G 15: 81,682,014 D346G possibly damaging Het
Lsm14a A G 7: 34,371,184 S96P probably damaging Het
Ltn1 A G 16: 87,382,713 L1520P probably damaging Het
March6 A T 15: 31,509,764 C26* probably null Het
Msra G A 14: 64,123,208 P228L probably damaging Het
Mycbp2 A T 14: 103,145,942 D395E probably benign Het
Mycbp2 T C 14: 103,208,893 Y1800C probably damaging Het
Ncr1 C A 7: 4,340,757 probably benign Het
Nkd1 T C 8: 88,591,650 I201T probably benign Het
Nsrp1 A T 11: 77,055,008 probably benign Het
Olfr330 A C 11: 58,529,785 I67S probably damaging Het
Pkdrej T C 15: 85,816,506 Y1743C probably damaging Het
Plekha5 T A 6: 140,580,499 H281Q possibly damaging Het
Ppp2r3a A C 9: 101,211,558 M522R probably damaging Het
Prdm12 T C 2: 31,640,313 F72S possibly damaging Het
Prima1 A T 12: 103,202,690 F106L probably damaging Het
Ptchd4 A G 17: 42,317,074 H142R probably benign Het
Rasgrf2 G A 13: 91,972,255 A793V probably benign Het
Rbsn T A 6: 92,189,873 M597L probably benign Het
Ripk4 A T 16: 97,743,733 D571E probably damaging Het
Rp9 T C 9: 22,468,129 K25E possibly damaging Het
Sec31b T C 19: 44,534,696 S211G probably damaging Het
Shank2 C T 7: 144,411,234 P1070S probably damaging Het
Sla A G 15: 66,782,714 V241A probably benign Het
Slc25a40 A G 5: 8,427,489 T25A possibly damaging Het
Slc3a2 A G 19: 8,708,244 S164P probably benign Het
Slc7a5 A T 8: 121,883,705 W457R probably null Het
Slco6c1 A G 1: 97,104,817 M303T probably benign Het
Smim10l1 T C 6: 133,105,526 F12S probably damaging Het
Syne2 A G 12: 75,952,786 I2318V probably damaging Het
Tecta A C 9: 42,340,285 C1781G probably damaging Het
Timmdc1 A T 16: 38,498,951 H280Q probably benign Het
Tktl2 G A 8: 66,512,347 V186M probably damaging Het
Tmem30b A G 12: 73,545,333 L336P probably damaging Het
Tmem94 A G 11: 115,794,749 I943V probably benign Het
Tshb A G 3: 102,778,148 probably null Het
Vcpip1 A G 1: 9,747,810 V116A probably benign Het
Vmn2r76 A G 7: 86,231,011 Y156H probably benign Het
Zcrb1 T C 15: 93,397,186 N23S probably damaging Het
Zfyve26 T C 12: 79,246,052 R2108G possibly damaging Het
Other mutations in Olfr873
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02122:Olfr873 APN 9 20300584 missense probably damaging 1.00
IGL02268:Olfr873 APN 9 20300292 missense probably damaging 1.00
IGL02416:Olfr873 APN 9 20300245 missense probably benign 0.01
IGL03124:Olfr873 APN 9 20301163 missense probably benign 0.00
R0147:Olfr873 UTSW 9 20301091 missense probably damaging 1.00
R0148:Olfr873 UTSW 9 20301091 missense probably damaging 1.00
R0266:Olfr873 UTSW 9 20301158 missense probably benign 0.01
R0831:Olfr873 UTSW 9 20300565 missense probably benign 0.20
R1456:Olfr873 UTSW 9 20300838 missense probably benign 0.35
R1894:Olfr873 UTSW 9 20300337 missense probably benign 0.23
R1928:Olfr873 UTSW 9 20301058 missense probably benign 0.12
R2379:Olfr873 UTSW 9 20300667 missense possibly damaging 0.87
R2911:Olfr873 UTSW 9 20300479 missense possibly damaging 0.60
R3788:Olfr873 UTSW 9 20300370 missense probably benign 0.13
R4657:Olfr873 UTSW 9 20300623 missense probably damaging 1.00
R5754:Olfr873 UTSW 9 20301094 missense probably damaging 1.00
R6291:Olfr873 UTSW 9 20300603 missense probably damaging 1.00
R6410:Olfr873 UTSW 9 20300452 missense probably damaging 1.00
R7014:Olfr873 UTSW 9 20300663 nonsense probably null
Predicted Primers PCR Primer
(F):5'- CCATAACTGAGATGGGGATTGATG -3'
(R):5'- CACAATCATCTTTGGGACTGTGG -3'

Sequencing Primer
(F):5'- TGCAGAAGATCAGTAATTTTGCC -3'
(R):5'- CTTTGGGACTGTGGTAGAGATAAAAC -3'
Posted On2014-10-01