Incidental Mutation 'R2135:Rp9'
ID235726
Institutional Source Beutler Lab
Gene Symbol Rp9
Ensembl Gene ENSMUSG00000032239
Gene Nameretinitis pigmentosa 9 (human)
SynonymsRp9h, PAP-1
MMRRC Submission 040138-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2135 (G1)
Quality Score112
Status Validated
Chromosome9
Chromosomal Location22411047-22469743 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 22468129 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Glutamic Acid at position 25 (K25E)
Ref Sequence ENSEMBL: ENSMUSP00000034763 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034763] [ENSMUST00000215715] [ENSMUST00000216973]
Predicted Effect possibly damaging
Transcript: ENSMUST00000034763
AA Change: K25E

PolyPhen 2 Score 0.677 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000034763
Gene: ENSMUSG00000032239
AA Change: K25E

DomainStartEndE-ValueType
low complexity region 19 28 N/A INTRINSIC
ZnF_C2HC 96 114 5.17e0 SMART
low complexity region 161 213 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000214005
Predicted Effect probably benign
Transcript: ENSMUST00000215715
AA Change: K25E

PolyPhen 2 Score 0.423 (Sensitivity: 0.89; Specificity: 0.90)
Predicted Effect probably benign
Transcript: ENSMUST00000216973
Predicted Effect noncoding transcript
Transcript: ENSMUST00000217370
Meta Mutation Damage Score 0.194 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.6%
Validation Efficiency 100% (70/70)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene can be bound and phosphorylated by the protooncogene PIM1 product, a serine/threonine protein kinase . This protein localizes in nuclear speckles containing the splicing factors, and has a role in pre-mRNA splicing. CBF1-interacting protein (CIR), a corepressor of CBF1, can also bind to this protein and effects alternative splicing. Mutations in this gene result in autosomal dominant retinitis pigmentosa-9. This gene has a pseudogene (GeneID: 441212), which is located in tandem array approximately 166 kb distal to this gene. [provided by RefSeq, Sep 2009]
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930522L14Rik A T 5: 109,737,643 H116Q probably benign Het
9230110F15Rik A C 9: 35,839,183 probably null Het
Adamts16 C A 13: 70,801,007 L178F probably damaging Het
Adgrv1 A G 13: 81,524,557 probably null Het
Akap9 A G 5: 4,064,509 T46A probably damaging Het
Ankrd2 T C 19: 42,044,059 L253P probably damaging Het
Arap3 T C 18: 37,974,456 D1336G probably damaging Het
Cacna2d2 C A 9: 107,526,513 L992I possibly damaging Het
Cdhr2 T A 13: 54,720,947 I574N probably damaging Het
Cecr2 C T 6: 120,720,962 T74M probably damaging Het
Ces5a C A 8: 93,499,741 E481D probably benign Het
Cfap74 C G 4: 155,429,940 N544K probably damaging Het
Cfap74 T A 4: 155,429,951 L548Q probably damaging Het
Cfb C T 17: 34,857,278 V1145I possibly damaging Het
CK137956 A G 4: 127,951,640 probably benign Het
Commd10 T A 18: 46,990,537 L153Q possibly damaging Het
Cox6c T C 15: 35,937,283 probably benign Het
Dock4 A G 12: 40,745,668 Y828C probably benign Het
Ermp1 T C 19: 29,646,065 D119G possibly damaging Het
Ext1 G T 15: 53,101,744 Q409K possibly damaging Het
Fat4 A T 3: 38,980,733 I2845F probably damaging Het
Frmd6 A G 12: 70,894,997 N494S probably benign Het
Fscn3 A G 6: 28,431,584 T305A probably benign Het
Gbx1 G T 5: 24,526,222 R199S possibly damaging Het
Gm11437 T C 11: 84,153,812 R192G probably damaging Het
Gucy2c T A 6: 136,723,728 D572V probably damaging Het
Idh1 A C 1: 65,161,919 M291R probably damaging Het
Kcnt2 A G 1: 140,428,813 Y330C probably damaging Het
Kdm4a A G 4: 118,142,459 L922P probably damaging Het
L3mbtl2 A G 15: 81,682,014 D346G possibly damaging Het
Lsm14a A G 7: 34,371,184 S96P probably damaging Het
Ltn1 A G 16: 87,382,713 L1520P probably damaging Het
March6 A T 15: 31,509,764 C26* probably null Het
Msra G A 14: 64,123,208 P228L probably damaging Het
Mycbp2 A T 14: 103,145,942 D395E probably benign Het
Mycbp2 T C 14: 103,208,893 Y1800C probably damaging Het
Ncr1 C A 7: 4,340,757 probably benign Het
Nkd1 T C 8: 88,591,650 I201T probably benign Het
Nsrp1 A T 11: 77,055,008 probably benign Het
Olfr330 A C 11: 58,529,785 I67S probably damaging Het
Olfr873 T A 9: 20,300,297 D32E probably benign Het
Pkdrej T C 15: 85,816,506 Y1743C probably damaging Het
Plekha5 T A 6: 140,580,499 H281Q possibly damaging Het
Ppp2r3a A C 9: 101,211,558 M522R probably damaging Het
Prdm12 T C 2: 31,640,313 F72S possibly damaging Het
Prima1 A T 12: 103,202,690 F106L probably damaging Het
Ptchd4 A G 17: 42,317,074 H142R probably benign Het
Rasgrf2 G A 13: 91,972,255 A793V probably benign Het
Rbsn T A 6: 92,189,873 M597L probably benign Het
Ripk4 A T 16: 97,743,733 D571E probably damaging Het
Sec31b T C 19: 44,534,696 S211G probably damaging Het
Shank2 C T 7: 144,411,234 P1070S probably damaging Het
Sla A G 15: 66,782,714 V241A probably benign Het
Slc25a40 A G 5: 8,427,489 T25A possibly damaging Het
Slc3a2 A G 19: 8,708,244 S164P probably benign Het
Slc7a5 A T 8: 121,883,705 W457R probably null Het
Slco6c1 A G 1: 97,104,817 M303T probably benign Het
Smim10l1 T C 6: 133,105,526 F12S probably damaging Het
Syne2 A G 12: 75,952,786 I2318V probably damaging Het
Tecta A C 9: 42,340,285 C1781G probably damaging Het
Timmdc1 A T 16: 38,498,951 H280Q probably benign Het
Tktl2 G A 8: 66,512,347 V186M probably damaging Het
Tmem30b A G 12: 73,545,333 L336P probably damaging Het
Tmem94 A G 11: 115,794,749 I943V probably benign Het
Tshb A G 3: 102,778,148 probably null Het
Vcpip1 A G 1: 9,747,810 V116A probably benign Het
Vmn2r76 A G 7: 86,231,011 Y156H probably benign Het
Zcrb1 T C 15: 93,397,186 N23S probably damaging Het
Zfyve26 T C 12: 79,246,052 R2108G possibly damaging Het
Other mutations in Rp9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03210:Rp9 APN 9 22457428 missense probably benign 0.40
R0512:Rp9 UTSW 9 22458719 missense probably benign 0.00
R1157:Rp9 UTSW 9 22458740 missense probably damaging 1.00
R1500:Rp9 UTSW 9 22457455 missense probably damaging 1.00
R1677:Rp9 UTSW 9 22453801 missense probably damaging 0.99
R3944:Rp9 UTSW 9 22449858 missense probably damaging 1.00
R5747:Rp9 UTSW 9 22448664 intron probably benign
R5853:Rp9 UTSW 9 22448769 intron probably benign
R6342:Rp9 UTSW 9 22449858 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TACAGTCGTCGCAGGTCATC -3'
(R):5'- AAGACCTTTGACACCTTGCCC -3'

Sequencing Primer
(F):5'- ACGCGTCAACTGCCATTG -3'
(R):5'- TCTCAGCTAAGGTTCCCGCAG -3'
Posted On2014-10-01