Incidental Mutation 'R0200:Man1a'
ID23577
Institutional Source Beutler Lab
Gene Symbol Man1a
Ensembl Gene ENSMUSG00000003746
Gene Namemannosidase 1, alpha
Synonymsmannosyl-oligosaccharide alpha-1,2-mannosidase, PCR1
MMRRC Submission 038457-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.628) question?
Stock #R0200 (G1)
Quality Score225
Status Not validated
Chromosome10
Chromosomal Location53904785-54076609 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 54074498 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 176 (V176A)
Ref Sequence ENSEMBL: ENSMUSP00000151328 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000003843] [ENSMUST00000105470] [ENSMUST00000218317] [ENSMUST00000220088]
Predicted Effect probably benign
Transcript: ENSMUST00000003843
AA Change: V176A

PolyPhen 2 Score 0.050 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000003843
Gene: ENSMUSG00000003746
AA Change: V176A

DomainStartEndE-ValueType
transmembrane domain 5 27 N/A INTRINSIC
transmembrane domain 44 66 N/A INTRINSIC
coiled coil region 116 151 N/A INTRINSIC
Pfam:Glyco_hydro_47 204 642 4.6e-150 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000105469
SMART Domains Protein: ENSMUSP00000101109
Gene: ENSMUSG00000003746

DomainStartEndE-ValueType
transmembrane domain 5 27 N/A INTRINSIC
transmembrane domain 44 66 N/A INTRINSIC
coiled coil region 116 151 N/A INTRINSIC
Pfam:Glyco_hydro_47 204 332 2.5e-38 PFAM
coiled coil region 346 376 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000105470
AA Change: V176A

PolyPhen 2 Score 0.050 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000101110
Gene: ENSMUSG00000003746
AA Change: V176A

DomainStartEndE-ValueType
transmembrane domain 5 27 N/A INTRINSIC
transmembrane domain 44 66 N/A INTRINSIC
coiled coil region 116 151 N/A INTRINSIC
Pfam:Glyco_hydro_47 204 642 4.5e-153 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133330
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146483
Predicted Effect noncoding transcript
Transcript: ENSMUST00000181899
Predicted Effect probably damaging
Transcript: ENSMUST00000218317
AA Change: V176A

PolyPhen 2 Score 0.963 (Sensitivity: 0.78; Specificity: 0.95)
Predicted Effect probably benign
Transcript: ENSMUST00000220088
AA Change: V267A

PolyPhen 2 Score 0.017 (Sensitivity: 0.95; Specificity: 0.80)
Coding Region Coverage
  • 1x: 98.8%
  • 3x: 97.8%
  • 10x: 94.7%
  • 20x: 86.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a class I mammalian Golgi 1,2-mannosidase which is a type II transmembrane protein. This protein catalyzes the hydrolysis of three terminal mannose residues from peptide-bound Man(9)-GlcNAc(2) oligosaccharides and belongs to family 47 of glycosyl hydrolases. [provided by RefSeq, Jul 2012]
Allele List at MGI
Other mutations in this stock
Total: 86 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A730017C20Rik A G 18: 59,062,459 probably null Het
Aatf T C 11: 84,445,676 K466E probably damaging Het
Abcc3 T C 11: 94,355,074 D1245G probably damaging Het
Adam12 T C 7: 133,974,416 probably null Het
Akap11 A G 14: 78,510,753 V1398A probably benign Het
Ank1 T G 8: 23,096,812 L461R probably damaging Het
Ankfn1 T C 11: 89,441,966 S402G possibly damaging Het
Arhgef40 A C 14: 51,996,974 E911D probably damaging Het
Atp2b1 C T 10: 98,979,814 Q107* probably null Het
BC117090 T C 16: 36,323,024 probably null Het
Cacng3 T A 7: 122,671,785 C4* probably null Het
Ccdc129 T C 6: 55,897,956 L297P probably benign Het
Cds1 G A 5: 101,814,433 V305M probably damaging Het
Cecr2 T G 6: 120,761,797 F1162V probably damaging Het
Cfap70 A T 14: 20,448,563 Y19N probably damaging Het
Chrm5 A G 2: 112,480,720 V17A probably benign Het
Col20a1 T C 2: 181,000,438 I714T probably damaging Het
Cpeb2 T A 5: 43,261,776 M156K possibly damaging Het
Defb25 C A 2: 152,622,412 V71L probably benign Het
Dhx35 A T 2: 158,829,623 M325L probably benign Het
Dhx57 A T 17: 80,251,473 L1019H probably damaging Het
Dnah6 T A 6: 73,069,420 D3195V probably damaging Het
Dph5 A G 3: 115,928,703 S277G probably benign Het
Dpm1 C A 2: 168,223,155 probably null Het
Dsg1a A T 18: 20,340,938 M1023L probably benign Het
Egf A G 3: 129,706,233 Y252H probably benign Het
Egf A G 3: 129,737,549 S126P probably damaging Het
Enam T C 5: 88,493,027 W183R possibly damaging Het
Foxn1 T C 11: 78,361,040 Y455C probably damaging Het
Gm14085 T A 2: 122,527,447 *661R probably null Het
Iars A T 13: 49,726,202 D983V possibly damaging Het
Ikzf4 C A 10: 128,634,676 G325V probably damaging Het
Il1rl1 T A 1: 40,441,303 W31R possibly damaging Het
Ip6k3 C T 17: 27,145,025 D350N probably damaging Het
Irgc1 T C 7: 24,432,006 D462G probably benign Het
Jph3 A G 8: 121,784,833 E520G probably benign Het
Kcna2 T A 3: 107,105,160 D352E probably benign Het
Klk4 T A 7: 43,885,361 I248N probably damaging Het
Krtap16-1 T C 11: 99,985,297 Y427C probably damaging Het
Lgr4 A G 2: 109,970,690 probably null Het
Lhpp C T 7: 132,610,677 probably benign Het
Lypd3 T A 7: 24,640,231 V241D probably damaging Het
Lyz2 T A 10: 117,280,773 N57Y possibly damaging Het
Mcm4 G A 16: 15,629,639 T487I probably benign Het
Mettl21c T A 1: 44,013,654 I68F probably damaging Het
Miip T A 4: 147,862,263 T313S probably damaging Het
Mog A T 17: 37,012,419 I209K probably damaging Het
Myo1c C A 11: 75,672,182 D997E probably benign Het
Npc1 T C 18: 12,219,204 Y146C probably damaging Het
Nploc4 A G 11: 120,413,681 L238P probably damaging Het
Olfr231 T C 1: 174,117,512 H168R probably benign Het
Olfr531 T C 7: 140,400,875 Y57C probably damaging Het
Olfr56 T A 11: 49,135,047 M285K probably damaging Het
Opa1 A G 16: 29,614,129 N544S probably benign Het
Pam C T 1: 97,894,401 probably null Het
Pdgfra T C 5: 75,163,777 Y98H probably damaging Het
Plcz1 C T 6: 139,990,733 R590H probably damaging Het
Plxdc1 T C 11: 97,934,012 Y339C probably damaging Het
Plxna1 T C 6: 89,323,593 N1583S probably damaging Het
Plxna4 C T 6: 32,197,088 V1191M probably damaging Het
Polk T A 13: 96,496,822 N238Y probably benign Het
Ptprq T C 10: 107,685,157 N718S probably benign Het
Rsrc1 A T 3: 67,180,861 H176L probably damaging Het
Sbno1 T C 5: 124,384,541 D1072G probably damaging Het
Scmh1 A G 4: 120,483,831 K238R probably damaging Het
Senp7 A G 16: 56,123,873 T187A possibly damaging Het
Slc12a4 T C 8: 105,951,617 R315G probably benign Het
Slc16a10 A G 10: 40,040,616 V430A probably benign Het
Slc26a7 T C 4: 14,621,317 D23G probably benign Het
Slc7a7 A G 14: 54,377,802 L246P probably damaging Het
Spata7 T A 12: 98,663,169 S332T probably benign Het
Spsb1 A G 4: 149,898,216 *274R probably null Het
Sspo T G 6: 48,486,415 V3767G probably null Het
Syt10 C A 15: 89,826,941 A130S probably benign Het
Tgm6 T A 2: 130,152,945 probably null Het
Them7 A C 2: 105,297,917 N81T probably damaging Het
Tinag C A 9: 76,951,935 A464S probably damaging Het
Tmem217 T G 17: 29,526,310 I149L probably benign Het
Trp53rkb T G 2: 166,795,683 D186E probably damaging Het
Vmn1r20 T C 6: 57,432,099 Y137H probably damaging Het
Vmn1r60 T A 7: 5,544,380 L240F probably benign Het
Vmn1r64 A G 7: 5,883,818 M242T probably benign Het
Xkr4 T C 1: 3,670,663 N229S probably benign Het
Zcchc2 T A 1: 106,004,123 L352M probably damaging Het
Zfp217 C T 2: 170,115,462 A539T probably benign Het
Zfp638 T C 6: 83,967,354 L1018P probably damaging Het
Other mutations in Man1a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01111:Man1a APN 10 53977013 splice site probably benign
IGL01146:Man1a APN 10 53907519 missense possibly damaging 0.90
IGL01412:Man1a APN 10 54074714 missense probably benign 0.00
IGL02009:Man1a APN 10 53925525 missense probably damaging 1.00
IGL02026:Man1a APN 10 54014473 missense probably damaging 1.00
IGL02745:Man1a APN 10 53977110 missense probably damaging 0.99
IGL02851:Man1a APN 10 53919244 missense probably damaging 1.00
IGL02929:Man1a APN 10 53925435 missense probably benign 0.00
R0046:Man1a UTSW 10 53919187 missense probably damaging 1.00
R0046:Man1a UTSW 10 53919187 missense probably damaging 1.00
R0101:Man1a UTSW 10 54075024 start codon destroyed probably null
R0463:Man1a UTSW 10 54074498 missense probably damaging 0.96
R0947:Man1a UTSW 10 53933523 nonsense probably null
R1219:Man1a UTSW 10 53919153 splice site probably benign
R1876:Man1a UTSW 10 53919172 missense probably damaging 1.00
R2142:Man1a UTSW 10 53934998 missense probably damaging 1.00
R2219:Man1a UTSW 10 53977049 missense probably damaging 0.99
R3117:Man1a UTSW 10 54030794 missense probably damaging 0.97
R3119:Man1a UTSW 10 54030794 missense probably damaging 0.97
R4727:Man1a UTSW 10 53907572 splice site probably null
R4942:Man1a UTSW 10 53933490 critical splice donor site probably null
R5493:Man1a UTSW 10 54074480 missense probably benign 0.25
R5921:Man1a UTSW 10 53907510 missense probably damaging 0.97
R5965:Man1a UTSW 10 53933490 critical splice donor site probably benign
R6084:Man1a UTSW 10 53919211 missense probably damaging 1.00
R6199:Man1a UTSW 10 54014456 missense possibly damaging 0.70
R6362:Man1a UTSW 10 54074795 missense probably benign 0.25
R6543:Man1a UTSW 10 53934981 nonsense probably null
R6711:Man1a UTSW 10 53933492 missense probably benign 0.00
R6982:Man1a UTSW 10 54074723 missense possibly damaging 0.92
R7061:Man1a UTSW 10 53920235 missense probably damaging 1.00
R7063:Man1a UTSW 10 54030744 missense probably damaging 1.00
R7220:Man1a UTSW 10 53920235 missense possibly damaging 0.95
R7361:Man1a UTSW 10 53908009 missense probably damaging 1.00
R7392:Man1a UTSW 10 53919187 missense probably damaging 1.00
R7566:Man1a UTSW 10 53919234 missense possibly damaging 0.93
Predicted Primers PCR Primer
(F):5'- GCTGCTCAGTACCTGCACAATGAC -3'
(R):5'- GCTGGACTGGAAGACAACTTAGCC -3'

Sequencing Primer
(F):5'- TTCAATGGGATTCAGCCCCAG -3'
(R):5'- TTAGCCAGGATCCGCGAAAA -3'
Posted On2013-04-16