Incidental Mutation 'R0200:Ptprq'
ID23579
Institutional Source Beutler Lab
Gene Symbol Ptprq
Ensembl Gene ENSMUSG00000035916
Gene Nameprotein tyrosine phosphatase, receptor type, Q
Synonyms
MMRRC Submission 038457-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.385) question?
Stock #R0200 (G1)
Quality Score225
Status Not validated
Chromosome10
Chromosomal Location107517049-107720051 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 107685157 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 718 (N718S)
Ref Sequence ENSEMBL: ENSMUSP00000058572 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000050702]
Predicted Effect probably benign
Transcript: ENSMUST00000050702
AA Change: N718S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000058572
Gene: ENSMUSG00000035916
AA Change: N718S

DomainStartEndE-ValueType
FN3 57 141 3.17e-13 SMART
FN3 156 294 1.55e-7 SMART
FN3 307 384 4.45e-8 SMART
FN3 398 555 1.17e-7 SMART
FN3 569 648 7.06e-11 SMART
FN3 666 743 7.68e-12 SMART
FN3 760 839 1.88e-6 SMART
FN3 855 932 1.33e-6 SMART
FN3 949 1037 2.31e-6 SMART
FN3 1054 1135 1.24e-6 SMART
FN3 1151 1229 2.39e-8 SMART
FN3 1244 1325 6.29e-8 SMART
FN3 1341 1416 2.87e-11 SMART
FN3 1431 1524 2.82e-10 SMART
FN3 1540 1622 6.35e-4 SMART
FN3 1642 1732 7.93e-5 SMART
transmembrane domain 1907 1929 N/A INTRINSIC
PTPc 2003 2262 1.14e-130 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000218399
Coding Region Coverage
  • 1x: 98.8%
  • 3x: 97.8%
  • 10x: 94.7%
  • 20x: 86.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This locus encodes a member of the type III receptor-like protein-tyrosine phosphatase family. The encoded protein catalyzes the dephosphorylation of phosphotyrosine and phosphatidylinositol and plays roles in cellular proliferation and differentiation. Mutations at this locus have been linked to autosomal recessive deafness. [provided by RefSeq, Mar 2014]
PHENOTYPE: Homozygotes for targeted mutations show absence of shaft connectors from vestibular hair bundles, postnatal degeneration in cochlear hair-bundle structure, reduced transducer currents but otherwise normal adaptation properties, a progressive loss of basal-coil cochlear hair cells, and deafness. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 86 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A730017C20Rik A G 18: 59,062,459 probably null Het
Aatf T C 11: 84,445,676 K466E probably damaging Het
Abcc3 T C 11: 94,355,074 D1245G probably damaging Het
Adam12 T C 7: 133,974,416 probably null Het
Akap11 A G 14: 78,510,753 V1398A probably benign Het
Ank1 T G 8: 23,096,812 L461R probably damaging Het
Ankfn1 T C 11: 89,441,966 S402G possibly damaging Het
Arhgef40 A C 14: 51,996,974 E911D probably damaging Het
Atp2b1 C T 10: 98,979,814 Q107* probably null Het
BC117090 T C 16: 36,323,024 probably null Het
Cacng3 T A 7: 122,671,785 C4* probably null Het
Ccdc129 T C 6: 55,897,956 L297P probably benign Het
Cds1 G A 5: 101,814,433 V305M probably damaging Het
Cecr2 T G 6: 120,761,797 F1162V probably damaging Het
Cfap70 A T 14: 20,448,563 Y19N probably damaging Het
Chrm5 A G 2: 112,480,720 V17A probably benign Het
Col20a1 T C 2: 181,000,438 I714T probably damaging Het
Cpeb2 T A 5: 43,261,776 M156K possibly damaging Het
Defb25 C A 2: 152,622,412 V71L probably benign Het
Dhx35 A T 2: 158,829,623 M325L probably benign Het
Dhx57 A T 17: 80,251,473 L1019H probably damaging Het
Dnah6 T A 6: 73,069,420 D3195V probably damaging Het
Dph5 A G 3: 115,928,703 S277G probably benign Het
Dpm1 C A 2: 168,223,155 probably null Het
Dsg1a A T 18: 20,340,938 M1023L probably benign Het
Egf A G 3: 129,706,233 Y252H probably benign Het
Egf A G 3: 129,737,549 S126P probably damaging Het
Enam T C 5: 88,493,027 W183R possibly damaging Het
Foxn1 T C 11: 78,361,040 Y455C probably damaging Het
Gm14085 T A 2: 122,527,447 *661R probably null Het
Iars A T 13: 49,726,202 D983V possibly damaging Het
Ikzf4 C A 10: 128,634,676 G325V probably damaging Het
Il1rl1 T A 1: 40,441,303 W31R possibly damaging Het
Ip6k3 C T 17: 27,145,025 D350N probably damaging Het
Irgc1 T C 7: 24,432,006 D462G probably benign Het
Jph3 A G 8: 121,784,833 E520G probably benign Het
Kcna2 T A 3: 107,105,160 D352E probably benign Het
Klk4 T A 7: 43,885,361 I248N probably damaging Het
Krtap16-1 T C 11: 99,985,297 Y427C probably damaging Het
Lgr4 A G 2: 109,970,690 probably null Het
Lhpp C T 7: 132,610,677 probably benign Het
Lypd3 T A 7: 24,640,231 V241D probably damaging Het
Lyz2 T A 10: 117,280,773 N57Y possibly damaging Het
Man1a A G 10: 54,074,498 V176A probably damaging Het
Mcm4 G A 16: 15,629,639 T487I probably benign Het
Mettl21c T A 1: 44,013,654 I68F probably damaging Het
Miip T A 4: 147,862,263 T313S probably damaging Het
Mog A T 17: 37,012,419 I209K probably damaging Het
Myo1c C A 11: 75,672,182 D997E probably benign Het
Npc1 T C 18: 12,219,204 Y146C probably damaging Het
Nploc4 A G 11: 120,413,681 L238P probably damaging Het
Olfr231 T C 1: 174,117,512 H168R probably benign Het
Olfr531 T C 7: 140,400,875 Y57C probably damaging Het
Olfr56 T A 11: 49,135,047 M285K probably damaging Het
Opa1 A G 16: 29,614,129 N544S probably benign Het
Pam C T 1: 97,894,401 probably null Het
Pdgfra T C 5: 75,163,777 Y98H probably damaging Het
Plcz1 C T 6: 139,990,733 R590H probably damaging Het
Plxdc1 T C 11: 97,934,012 Y339C probably damaging Het
Plxna1 T C 6: 89,323,593 N1583S probably damaging Het
Plxna4 C T 6: 32,197,088 V1191M probably damaging Het
Polk T A 13: 96,496,822 N238Y probably benign Het
Rsrc1 A T 3: 67,180,861 H176L probably damaging Het
Sbno1 T C 5: 124,384,541 D1072G probably damaging Het
Scmh1 A G 4: 120,483,831 K238R probably damaging Het
Senp7 A G 16: 56,123,873 T187A possibly damaging Het
Slc12a4 T C 8: 105,951,617 R315G probably benign Het
Slc16a10 A G 10: 40,040,616 V430A probably benign Het
Slc26a7 T C 4: 14,621,317 D23G probably benign Het
Slc7a7 A G 14: 54,377,802 L246P probably damaging Het
Spata7 T A 12: 98,663,169 S332T probably benign Het
Spsb1 A G 4: 149,898,216 *274R probably null Het
Sspo T G 6: 48,486,415 V3767G probably null Het
Syt10 C A 15: 89,826,941 A130S probably benign Het
Tgm6 T A 2: 130,152,945 probably null Het
Them7 A C 2: 105,297,917 N81T probably damaging Het
Tinag C A 9: 76,951,935 A464S probably damaging Het
Tmem217 T G 17: 29,526,310 I149L probably benign Het
Trp53rkb T G 2: 166,795,683 D186E probably damaging Het
Vmn1r20 T C 6: 57,432,099 Y137H probably damaging Het
Vmn1r60 T A 7: 5,544,380 L240F probably benign Het
Vmn1r64 A G 7: 5,883,818 M242T probably benign Het
Xkr4 T C 1: 3,670,663 N229S probably benign Het
Zcchc2 T A 1: 106,004,123 L352M probably damaging Het
Zfp217 C T 2: 170,115,462 A539T probably benign Het
Zfp638 T C 6: 83,967,354 L1018P probably damaging Het
Other mutations in Ptprq
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00340:Ptprq APN 10 107576929 missense probably damaging 0.98
IGL00537:Ptprq APN 10 107710522 missense probably benign 0.07
IGL00547:Ptprq APN 10 107718541 missense probably damaging 0.99
IGL00586:Ptprq APN 10 107608122 splice site probably benign
IGL00648:Ptprq APN 10 107646716 missense probably benign 0.10
IGL01123:Ptprq APN 10 107686218 missense probably damaging 0.96
IGL01343:Ptprq APN 10 107638839 missense probably damaging 0.96
IGL01348:Ptprq APN 10 107711904 missense probably damaging 1.00
IGL01433:Ptprq APN 10 107576880 missense probably damaging 0.99
IGL01510:Ptprq APN 10 107712048 missense probably damaging 1.00
IGL01535:Ptprq APN 10 107699596 missense probably benign
IGL01631:Ptprq APN 10 107643538 missense probably benign 0.00
IGL01633:Ptprq APN 10 107699723 splice site probably benign
IGL01702:Ptprq APN 10 107517866 missense probably benign 0.00
IGL01733:Ptprq APN 10 107662599 missense probably benign 0.10
IGL01806:Ptprq APN 10 107699608 missense probably damaging 1.00
IGL01832:Ptprq APN 10 107565839 critical splice donor site probably null
IGL01961:Ptprq APN 10 107643654 missense probably damaging 1.00
IGL02108:Ptprq APN 10 107646617 missense probably damaging 1.00
IGL02120:Ptprq APN 10 107667472 missense probably damaging 1.00
IGL02160:Ptprq APN 10 107653565 missense probably benign 0.00
IGL02178:Ptprq APN 10 107686319 missense probably benign 0.03
IGL02249:Ptprq APN 10 107582359 missense probably damaging 1.00
IGL02267:Ptprq APN 10 107646558 missense probably damaging 1.00
IGL02527:Ptprq APN 10 107686563 missense probably benign 0.04
IGL02529:Ptprq APN 10 107635365 missense probably benign 0.03
IGL02542:Ptprq APN 10 107662555 missense probably damaging 1.00
IGL02582:Ptprq APN 10 107643999 missense probably benign 0.00
IGL02708:Ptprq APN 10 107652700 missense probably damaging 1.00
IGL02894:Ptprq APN 10 107667424 missense probably benign
IGL02903:Ptprq APN 10 107666586 missense possibly damaging 0.51
IGL02951:Ptprq APN 10 107667460 missense probably benign 0.03
IGL02982:Ptprq APN 10 107586684 missense probably damaging 1.00
IGL03000:Ptprq APN 10 107542657 missense probably damaging 1.00
IGL03024:Ptprq APN 10 107685566 missense possibly damaging 0.69
IGL03240:Ptprq APN 10 107688507 missense probably benign
P0043:Ptprq UTSW 10 107580225 missense probably benign 0.03
PIT4812001:Ptprq UTSW 10 107666567 missense probably damaging 1.00
R0268:Ptprq UTSW 10 107705548 missense probably benign
R0276:Ptprq UTSW 10 107542735 critical splice acceptor site probably null
R0279:Ptprq UTSW 10 107608417 missense probably damaging 0.96
R0335:Ptprq UTSW 10 107708728 missense probably benign
R0344:Ptprq UTSW 10 107705582 missense probably benign
R0357:Ptprq UTSW 10 107686199 splice site probably benign
R0454:Ptprq UTSW 10 107582530 nonsense probably null
R0479:Ptprq UTSW 10 107643994 nonsense probably null
R0491:Ptprq UTSW 10 107608175 missense probably damaging 0.98
R0519:Ptprq UTSW 10 107538920 splice site probably benign
R0523:Ptprq UTSW 10 107580220 missense possibly damaging 0.54
R0553:Ptprq UTSW 10 107710627 missense probably benign 0.33
R0746:Ptprq UTSW 10 107517831 missense probably damaging 1.00
R0755:Ptprq UTSW 10 107582539 missense probably benign 0.09
R1434:Ptprq UTSW 10 107586714 missense probably damaging 1.00
R1445:Ptprq UTSW 10 107662562 missense probably damaging 1.00
R1470:Ptprq UTSW 10 107718574 missense probably damaging 0.97
R1470:Ptprq UTSW 10 107718574 missense probably damaging 0.97
R1558:Ptprq UTSW 10 107644043 missense probably damaging 1.00
R1567:Ptprq UTSW 10 107565887 missense probably benign 0.13
R1711:Ptprq UTSW 10 107534699 nonsense probably null
R1720:Ptprq UTSW 10 107686294 missense probably damaging 1.00
R1746:Ptprq UTSW 10 107638830 missense probably damaging 1.00
R1776:Ptprq UTSW 10 107685089 missense probably damaging 1.00
R1822:Ptprq UTSW 10 107718478 missense probably damaging 1.00
R1872:Ptprq UTSW 10 107643999 missense probably benign 0.19
R1944:Ptprq UTSW 10 107582388 missense probably benign 0.23
R1945:Ptprq UTSW 10 107582388 missense probably benign 0.23
R2006:Ptprq UTSW 10 107666546 missense probably damaging 1.00
R2014:Ptprq UTSW 10 107667422 missense probably damaging 0.96
R2015:Ptprq UTSW 10 107667422 missense probably damaging 0.96
R2097:Ptprq UTSW 10 107653493 missense probably benign 0.05
R2172:Ptprq UTSW 10 107590994 nonsense probably null
R2174:Ptprq UTSW 10 107705553 missense probably damaging 1.00
R2248:Ptprq UTSW 10 107643070 splice site probably null
R2404:Ptprq UTSW 10 107686599 missense probably damaging 1.00
R3423:Ptprq UTSW 10 107582476 missense probably damaging 0.99
R3683:Ptprq UTSW 10 107708628 missense probably benign 0.01
R3875:Ptprq UTSW 10 107685104 missense possibly damaging 0.88
R3945:Ptprq UTSW 10 107686392 splice site probably benign
R3946:Ptprq UTSW 10 107686392 splice site probably benign
R3974:Ptprq UTSW 10 107712062 missense possibly damaging 0.88
R3982:Ptprq UTSW 10 107543396 missense probably damaging 0.99
R4105:Ptprq UTSW 10 107572967 missense probably damaging 1.00
R4118:Ptprq UTSW 10 107711920 missense probably benign 0.37
R4175:Ptprq UTSW 10 107711917 missense probably benign
R4231:Ptprq UTSW 10 107686283 nonsense probably null
R4356:Ptprq UTSW 10 107608364 missense probably damaging 0.99
R4435:Ptprq UTSW 10 107685055 missense possibly damaging 0.89
R4678:Ptprq UTSW 10 107685182 missense probably benign 0.19
R4679:Ptprq UTSW 10 107685182 missense probably benign 0.19
R4745:Ptprq UTSW 10 107524253 missense probably damaging 1.00
R4771:Ptprq UTSW 10 107688427 missense probably benign
R4778:Ptprq UTSW 10 107591022 missense probably benign 0.15
R4808:Ptprq UTSW 10 107718507 missense probably damaging 1.00
R4809:Ptprq UTSW 10 107563175 missense probably damaging 1.00
R4818:Ptprq UTSW 10 107710581 missense possibly damaging 0.86
R4845:Ptprq UTSW 10 107653532 missense probably benign 0.00
R4901:Ptprq UTSW 10 107688414 missense probably benign 0.01
R4942:Ptprq UTSW 10 107688429 missense probably benign 0.01
R4946:Ptprq UTSW 10 107525734 missense probably benign
R4959:Ptprq UTSW 10 107686555 missense probably damaging 1.00
R4973:Ptprq UTSW 10 107686555 missense probably damaging 1.00
R5007:Ptprq UTSW 10 107608276 missense probably benign 0.00
R5053:Ptprq UTSW 10 107563202 missense probably damaging 1.00
R5055:Ptprq UTSW 10 107534679 missense probably benign 0.37
R5090:Ptprq UTSW 10 107526089 missense probably damaging 1.00
R5158:Ptprq UTSW 10 107534704 missense probably damaging 1.00
R5163:Ptprq UTSW 10 107524331 missense probably damaging 1.00
R5222:Ptprq UTSW 10 107662564 missense probably damaging 0.96
R5244:Ptprq UTSW 10 107586695 missense possibly damaging 0.62
R5249:Ptprq UTSW 10 107699635 missense probably damaging 0.99
R5503:Ptprq UTSW 10 107688328 splice site probably null
R5508:Ptprq UTSW 10 107686231 missense probably benign 0.00
R5601:Ptprq UTSW 10 107608430 missense probably benign
R5722:Ptprq UTSW 10 107686365 missense possibly damaging 0.72
R5819:Ptprq UTSW 10 107719883 start gained probably benign
R5862:Ptprq UTSW 10 107565878 missense probably benign 0.02
R5891:Ptprq UTSW 10 107576895 missense possibly damaging 0.94
R5916:Ptprq UTSW 10 107523513 missense probably damaging 1.00
R6054:Ptprq UTSW 10 107582358 missense probably damaging 1.00
R6058:Ptprq UTSW 10 107635274 missense probably benign 0.00
R6075:Ptprq UTSW 10 107525760 missense probably damaging 1.00
R6101:Ptprq UTSW 10 107580266 missense possibly damaging 0.93
R6189:Ptprq UTSW 10 107517887 missense probably damaging 1.00
R6235:Ptprq UTSW 10 107635338 missense possibly damaging 0.61
R6351:Ptprq UTSW 10 107708668 missense probably damaging 0.99
R6394:Ptprq UTSW 10 107642943 nonsense probably null
R6449:Ptprq UTSW 10 107705583 missense probably benign 0.00
R6526:Ptprq UTSW 10 107542653 nonsense probably null
R6544:Ptprq UTSW 10 107608241 missense probably damaging 1.00
R6609:Ptprq UTSW 10 107572968 missense probably damaging 0.99
R6862:Ptprq UTSW 10 107686225 missense probably damaging 0.96
R6874:Ptprq UTSW 10 107718599 missense possibly damaging 0.80
R6892:Ptprq UTSW 10 107576004 missense probably benign 0.00
R7082:Ptprq UTSW 10 107708730 missense probably benign 0.10
R7210:Ptprq UTSW 10 107685171 missense probably damaging 1.00
R7253:Ptprq UTSW 10 107608273 missense probably benign 0.30
R7293:Ptprq UTSW 10 107635506 nonsense probably null
Z1088:Ptprq UTSW 10 107699672 missense possibly damaging 0.56
Predicted Primers PCR Primer
(F):5'- TCTGAATGTTGCTCTGCTAAAGTCTGC -3'
(R):5'- CCTCATGGCTGCTTCAGTGTCTAAAAC -3'

Sequencing Primer
(F):5'- CAGACACATTGGATGAGTCTTTG -3'
(R):5'- AAGTTGTGTTCTATTCTTCCCAGAG -3'
Posted On2013-04-16